EMAIL THIS PAGE TO A FRIEND

SPACA1

sperm acrosome associated 1

Synonyms: SAMP32
UniProtKB ID: Q9HBV2
Gene ID:
Human(81833) Summary: The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from infertile males. Furthermore, antibodies generated against the recombinant protein block in vitro fertilization. This protein localizes to the acrosomal membrane of spermatids and mature spermatozoa where it is thought to play a role in acrosomal morphogenesis and in sperm-egg binding and fusion, respectively. [provided by RefSeq, Jul 2008]
Mouse(67652) sperm acrosome associated 1
Rat(500432) sperm acrosome associated 1
chicken(421820) sperm acrosome associated 1
dog(611635) sperm acrosome associated 1
domestic cat(101091941) sperm acrosome associated 1
naked mole-rat(101703197) sperm acrosome associated 1
domestic guinea pig(100728130) sperm acrosome associated 1
cow(614884) sperm acrosome associated 1
sheep(101112231) sperm acrosome associated 1
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030960 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030960 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030960 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026293 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026293 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026293 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030960 Rosetta Predictions human pricing
XM_001064553 Rosetta Predictions rat pricing
XM_575794 Rosetta Predictions rat pricing
NM_026293 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030960 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202974 predicted 338
2 SASI_Hs01_00202976 predicted 288
3 SASI_Hs01_00202977 predicted 498
4 SASI_Hs01_00202978 predicted 390
5 SASI_Hs01_00202979 predicted 917
6 SASI_Hs02_00358540 predicted 623
7 SASI_Hs01_00202980 predicted 685
8 SASI_Hs01_00202981 predicted 433
9 SASI_Hs01_00202982 predicted 752
10 SASI_Hs02_00358541 predicted 596
11 SASI_Hs01_00202975 predicted 1078
12 SASI_Hs01_00202983 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310979 predicted 721
2 SASI_Rn02_00310980 predicted 617
3 SASI_Rn02_00310981 predicted 826
4 SASI_Rn02_00310982 predicted 811
5 SASI_Rn02_00310983 predicted 452
6 SASI_Rn02_00310984 predicted 829
7 SASI_Rn02_00310985 predicted 540
8 SASI_Rn02_00310986 predicted 598
9 SASI_Rn02_00310987 predicted 352
10 SASI_Rn02_00310988 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575794 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404343 predicted 730
2 SASI_Rn02_00404344 predicted 616
3 SASI_Rn02_00404345 predicted 824
4 SASI_Rn02_00404346 predicted 810
5 SASI_Rn02_00404347 predicted 450
6 SASI_Rn02_00404348 predicted 825
7 SASI_Rn02_00404349 predicted 541
8 SASI_Rn02_00404350 predicted 603
9 SASI_Rn02_00404351 predicted 355
10 SASI_Rn02_00404352 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026293 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132162 predicted 688
2 SASI_Mm01_00132163 predicted 580
3 SASI_Mm01_00132164 predicted 644
4 SASI_Mm01_00132165 predicted 587
5 SASI_Mm01_00132166 predicted 769
6 SASI_Mm01_00132167 predicted 758
7 SASI_Mm01_00132168 predicted 566
8 SASI_Mm01_00132169 predicted 786
9 SASI_Mm01_00132170 predicted 770
10 SASI_Mm01_00132171 predicted 711
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030960
SPACA1 MISSION shRNA Bacterial Glycerol Stock
sperm acrosome associated 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030960.2-1285s21c1
Sequence:CCGGTGATAACTTCTTAGGTGATTTCTCGAGAAATCACCTAAGAAGTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030960.2-386s21c1
Sequence:CCGGTTGGTGTTAGAGAAGTTATATCTCGAGATATAACTTCTCTAACACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030960.2-532s21c1
Sequence:CCGGATTCACACATCTCCCTTAAATCTCGAGATTTAAGGGAGATGTGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030960.2-318s1c1
Sequence:CCGGCGAGGATGTTTCAAATAGGAACTCGAGTTCCTATTTGAAACATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030960.2-1200s1c1
Sequence:CCGGCTCAACACTTATTTCAGGTAACTCGAGTTACCTGAAATAAGTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030960.2-940s1c1
Sequence:CCGGCTTGACCAATTACCAACAGAACTCGAGTTCTGTTGGTAATTGGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030960.2-906s1c1
Sequence:CCGGGCAGAGTTCTGTGAGATACAACTCGAGTTGTATCTCACAGAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030960.2-783s1c1
Sequence:CCGGGCTGACCATAGGAGTCATTATCTCGAGATAATGACTCCTATGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030960.2-758s1c1
Sequence:CCGGCCACTGATGCAGCCCTAATTTCTCGAGAAATTAGGGCTGCATCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030960.2-963s1c1
Sequence:CCGGGCCTGGTGAAGATGATGCTTTCTCGAGAAAGCATCATCTTCACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030960.2-661s1c1
Sequence:CCGGGAGTGTGACACACTGGATAATCTCGAGATTATCCAGTGTGTCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030960
SPACA1 MISSION shRNA shRNA Plasmid DNA
sperm acrosome associated 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030960.2-1285s21c1
Sequence:CCGGTGATAACTTCTTAGGTGATTTCTCGAGAAATCACCTAAGAAGTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030960.2-386s21c1
Sequence:CCGGTTGGTGTTAGAGAAGTTATATCTCGAGATATAACTTCTCTAACACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030960.2-532s21c1
Sequence:CCGGATTCACACATCTCCCTTAAATCTCGAGATTTAAGGGAGATGTGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030960.2-318s1c1
Sequence:CCGGCGAGGATGTTTCAAATAGGAACTCGAGTTCCTATTTGAAACATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030960.2-1200s1c1
Sequence:CCGGCTCAACACTTATTTCAGGTAACTCGAGTTACCTGAAATAAGTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030960.2-940s1c1
Sequence:CCGGCTTGACCAATTACCAACAGAACTCGAGTTCTGTTGGTAATTGGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030960.2-906s1c1
Sequence:CCGGGCAGAGTTCTGTGAGATACAACTCGAGTTGTATCTCACAGAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030960.2-783s1c1
Sequence:CCGGGCTGACCATAGGAGTCATTATCTCGAGATAATGACTCCTATGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030960.2-758s1c1
Sequence:CCGGCCACTGATGCAGCCCTAATTTCTCGAGAAATTAGGGCTGCATCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030960.2-963s1c1
Sequence:CCGGGCCTGGTGAAGATGATGCTTTCTCGAGAAAGCATCATCTTCACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030960.2-661s1c1
Sequence:CCGGGAGTGTGACACACTGGATAATCTCGAGATTATCCAGTGTGTCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030960
SPACA1 MISSION shRNA Lentiviral Transduction Particles
sperm acrosome associated 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030960.2-1285s21c1
Sequence:CCGGTGATAACTTCTTAGGTGATTTCTCGAGAAATCACCTAAGAAGTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030960.2-386s21c1
Sequence:CCGGTTGGTGTTAGAGAAGTTATATCTCGAGATATAACTTCTCTAACACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030960.2-532s21c1
Sequence:CCGGATTCACACATCTCCCTTAAATCTCGAGATTTAAGGGAGATGTGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030960.2-318s1c1
Sequence:CCGGCGAGGATGTTTCAAATAGGAACTCGAGTTCCTATTTGAAACATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030960.2-1200s1c1
Sequence:CCGGCTCAACACTTATTTCAGGTAACTCGAGTTACCTGAAATAAGTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030960.2-940s1c1
Sequence:CCGGCTTGACCAATTACCAACAGAACTCGAGTTCTGTTGGTAATTGGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030960.2-906s1c1
Sequence:CCGGGCAGAGTTCTGTGAGATACAACTCGAGTTGTATCTCACAGAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030960.2-783s1c1
Sequence:CCGGGCTGACCATAGGAGTCATTATCTCGAGATAATGACTCCTATGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030960.2-758s1c1
Sequence:CCGGCCACTGATGCAGCCCTAATTTCTCGAGAAATTAGGGCTGCATCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030960.2-963s1c1
Sequence:CCGGGCCTGGTGAAGATGATGCTTTCTCGAGAAAGCATCATCTTCACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030960.2-661s1c1
Sequence:CCGGGAGTGTGACACACTGGATAATCTCGAGATTATCCAGTGTGTCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026293
SPACA1 MISSION shRNA Bacterial Glycerol Stock
sperm acrosome associated 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026293.3-682s21c1
Sequence:CCGGCTGTTAAATTCACCGTCTATACTCGAGTATAGACGGTGAATTTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026293.3-370s21c1
Sequence:CCGGTTGGTATCAGAGAAGTAATTTCTCGAGAAATTACTTCTCTGATACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026293.3-505s21c1
Sequence:CCGGGACTATCATGTGTTCATATATCTCGAGATATATGAACACATGATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026293.3-777s21c1
Sequence:CCGGGGAGTCATTATCTGCATATTTCTCGAGAAATATGCAGATAATGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026293.3-647s21c1
Sequence:CCGGATGTGACACCTTGGATAATAACTCGAGTTATTATCCAAGGTGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026293
SPACA1 MISSION shRNA shRNA Plasmid DNA
sperm acrosome associated 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026293.3-682s21c1
Sequence:CCGGCTGTTAAATTCACCGTCTATACTCGAGTATAGACGGTGAATTTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026293.3-370s21c1
Sequence:CCGGTTGGTATCAGAGAAGTAATTTCTCGAGAAATTACTTCTCTGATACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026293.3-505s21c1
Sequence:CCGGGACTATCATGTGTTCATATATCTCGAGATATATGAACACATGATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026293.3-777s21c1
Sequence:CCGGGGAGTCATTATCTGCATATTTCTCGAGAAATATGCAGATAATGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026293.3-647s21c1
Sequence:CCGGATGTGACACCTTGGATAATAACTCGAGTTATTATCCAAGGTGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026293
SPACA1 MISSION shRNA Lentiviral Transduction Particles
sperm acrosome associated 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026293.3-682s21c1
Sequence:CCGGCTGTTAAATTCACCGTCTATACTCGAGTATAGACGGTGAATTTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026293.3-370s21c1
Sequence:CCGGTTGGTATCAGAGAAGTAATTTCTCGAGAAATTACTTCTCTGATACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026293.3-505s21c1
Sequence:CCGGGACTATCATGTGTTCATATATCTCGAGATATATGAACACATGATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026293.3-777s21c1
Sequence:CCGGGGAGTCATTATCTGCATATTTCTCGAGAAATATGCAGATAATGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026293.3-647s21c1
Sequence:CCGGATGTGACACCTTGGATAATAACTCGAGTTATTATCCAAGGTGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks