EMAIL THIS PAGE TO A FRIEND

SPACA3

sperm acrosome associated 3

Synonyms: 1700025M08Rik ALLP17 CT54 LYC3 LYZL3 SLLP1
UniProtKB ID: Q8IXA5, Q7Z4Y5
Gene ID:
Mouse(75622) sperm acrosome associated 3
Rat(287557) sperm acrosome associated 3
cow(617955) sperm acrosome associated 3
sheep(100462675) sperm acrosome associated 3
sheep(101114884) sperm acrosome associated 3
domestic guinea pig(100718028) sperm acrosome associated 3
naked mole-rat(101696386) sperm acrosome associated 3
dog(610702) sperm acrosome associated 3
domestic cat(101095930) sperm acrosome associated 3
Horse(100071732) sperm acrosome associated 3
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173847 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173847 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173847 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029367 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029367 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029367 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007911 MISSION® esiRNA esiRNA targeting human SPACA3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173847 Rosetta Predictions human pricing
NM_001105820 Rosetta Predictions rat pricing
NM_029367 Rosetta Predictions mouse pricing
XM_354632 Rosetta Predictions mouse pricing
XM_902822 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245142 predicted 484
2 SASI_Hs01_00245143 predicted 572
3 SASI_Hs01_00245145 predicted 556
4 SASI_Hs01_00245146 predicted 333
5 SASI_Hs01_00245147 predicted 211
6 SASI_Hs01_00245148 predicted 279
7 SASI_Hs01_00245149 predicted 330
8 SASI_Hs01_00245150 predicted 543
9 SASI_Hs01_00245151 predicted 362
10 SASI_Hs02_00368720 predicted 339
11 SASI_Hs01_00245144 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105820 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212856 predicted 681
2 SASI_Rn02_00212857 predicted 471
3 SASI_Rn02_00212858 predicted 673
4 SASI_Rn02_00212859 predicted 519
5 SASI_Rn02_00212860 predicted 514
6 SASI_Rn02_00212861 predicted 657
7 SASI_Rn02_00212862 predicted 679
8 SASI_Rn02_00212863 predicted 418
9 SASI_Rn02_00212864 predicted 330
10 SASI_Rn02_00212865 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335235 predicted 544
2 SASI_Mm02_00335236 predicted 545
3 SASI_Mm02_00335237 predicted 555
4 SASI_Mm02_00335238 predicted 418
5 SASI_Mm02_00335239 predicted 430
6 SASI_Mm02_00335240 predicted 540
7 SASI_Mm02_00335241 predicted 452
8 SASI_Mm02_00335242 predicted 304
9 SASI_Mm02_00335243 predicted 427
10 SASI_Mm02_00335244 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_354632 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274018 predicted 545
2 SASI_Mm01_00274019 predicted 563
3 SASI_Mm01_00274020 predicted 538
4 SASI_Mm01_00274021 predicted 559
5 SASI_Mm01_00274022 predicted 578
6 SASI_Mm01_00274023 predicted 576
7 SASI_Mm01_00274024 predicted 546
8 SASI_Mm01_00274025 predicted 499
9 SASI_Mm01_00274026 predicted 561
10 SASI_Mm01_00274027 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902822 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252575 predicted 399
2 SASI_Mm01_00252576 predicted 416
3 SASI_Mm01_00252577 predicted 401
4 SASI_Mm01_00252578 predicted 423
5 SASI_Mm01_00252579 predicted 435
6 SASI_Mm01_00252580 predicted 434
7 SASI_Mm01_00252581 predicted 398
8 SASI_Mm01_00252582 predicted 352
9 SASI_Mm01_00252583 predicted 416
10 SASI_Mm01_00252584 predicted 338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173847
SPACA3 MISSION shRNA Bacterial Glycerol Stock
sperm acrosome associated 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-492s1c1
Sequence:CCGGCAACGGGATCTTCCAGATCAACTCGAGTTGATCTGGAAGATCCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-601s1c1
Sequence:CCGGGATACCGTTATCTGTGCCATGCTCGAGCATGGCACAGATAACGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-561s1c1
Sequence:CCGGCCGGATGTACTGCTCAGATTTCTCGAGAAATCTGAGCAGTACATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-595s1c1
Sequence:CCGGCTCAAGGATACCGTTATCTGTCTCGAGACAGATAACGGTATCCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-564s1c1
Sequence:CCGGGATGTACTGCTCAGATTTGTTCTCGAGAACAAATCTGAGCAGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-567s1c1
Sequence:CCGGGTACTGCTCAGATTTGTTGAACTCGAGTTCAACAAATCTGAGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-590s1c1
Sequence:CCGGCTAATCTCAAGGATACCGTTACTCGAGTAACGGTATCCTTGAGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-606s1c1
Sequence:CCGGCGTTATCTGTGCCATGAAGATCTCGAGATCTTCATGGCACAGATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-123s1c1
Sequence:CCGGCCCTGTTTCTTCTCCTTCTGTCTCGAGACAGAAGGAGAAGAAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-621s1c1
Sequence:CCGGGAAGATAACCCAAGAGCCTCACTCGAGTGAGGCTCTTGGGTTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173847
SPACA3 MISSION shRNA shRNA Plasmid DNA
sperm acrosome associated 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-492s1c1
Sequence:CCGGCAACGGGATCTTCCAGATCAACTCGAGTTGATCTGGAAGATCCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-601s1c1
Sequence:CCGGGATACCGTTATCTGTGCCATGCTCGAGCATGGCACAGATAACGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-561s1c1
Sequence:CCGGCCGGATGTACTGCTCAGATTTCTCGAGAAATCTGAGCAGTACATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-595s1c1
Sequence:CCGGCTCAAGGATACCGTTATCTGTCTCGAGACAGATAACGGTATCCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-564s1c1
Sequence:CCGGGATGTACTGCTCAGATTTGTTCTCGAGAACAAATCTGAGCAGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-567s1c1
Sequence:CCGGGTACTGCTCAGATTTGTTGAACTCGAGTTCAACAAATCTGAGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-590s1c1
Sequence:CCGGCTAATCTCAAGGATACCGTTACTCGAGTAACGGTATCCTTGAGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-606s1c1
Sequence:CCGGCGTTATCTGTGCCATGAAGATCTCGAGATCTTCATGGCACAGATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-123s1c1
Sequence:CCGGCCCTGTTTCTTCTCCTTCTGTCTCGAGACAGAAGGAGAAGAAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-621s1c1
Sequence:CCGGGAAGATAACCCAAGAGCCTCACTCGAGTGAGGCTCTTGGGTTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173847
SPACA3 MISSION shRNA Lentiviral Transduction Particles
sperm acrosome associated 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-492s1c1
Sequence:CCGGCAACGGGATCTTCCAGATCAACTCGAGTTGATCTGGAAGATCCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-601s1c1
Sequence:CCGGGATACCGTTATCTGTGCCATGCTCGAGCATGGCACAGATAACGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-561s1c1
Sequence:CCGGCCGGATGTACTGCTCAGATTTCTCGAGAAATCTGAGCAGTACATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-595s1c1
Sequence:CCGGCTCAAGGATACCGTTATCTGTCTCGAGACAGATAACGGTATCCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-564s1c1
Sequence:CCGGGATGTACTGCTCAGATTTGTTCTCGAGAACAAATCTGAGCAGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-567s1c1
Sequence:CCGGGTACTGCTCAGATTTGTTGAACTCGAGTTCAACAAATCTGAGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-590s1c1
Sequence:CCGGCTAATCTCAAGGATACCGTTACTCGAGTAACGGTATCCTTGAGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-606s1c1
Sequence:CCGGCGTTATCTGTGCCATGAAGATCTCGAGATCTTCATGGCACAGATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-123s1c1
Sequence:CCGGCCCTGTTTCTTCTCCTTCTGTCTCGAGACAGAAGGAGAAGAAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173847.2-621s1c1
Sequence:CCGGGAAGATAACCCAAGAGCCTCACTCGAGTGAGGCTCTTGGGTTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029367
SPACA3 MISSION shRNA Bacterial Glycerol Stock
sperm acrosome associated 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000253240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029367.1-543s21c1
Sequence:CCGGAGGATATACTGCACTGATTTGCTCGAGCAAATCAGTGCAGTATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029367.1-457s21c1
Sequence:CCGGCTGATGGAAGCACCAACAATGCTCGAGCATTGTTGGTGCTTCCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029367.1-589s21c1
Sequence:CCGGTCGTCTGTGCCATGAAGATAGCTCGAGCTATCTTCATGGCACAGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029367.1-420s21c1
Sequence:CCGGACAAGTGGCTTCAACACAAATCTCGAGATTTGTGTTGAAGCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029367
SPACA3 MISSION shRNA shRNA Plasmid DNA
sperm acrosome associated 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000253240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029367.1-543s21c1
Sequence:CCGGAGGATATACTGCACTGATTTGCTCGAGCAAATCAGTGCAGTATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029367.1-457s21c1
Sequence:CCGGCTGATGGAAGCACCAACAATGCTCGAGCATTGTTGGTGCTTCCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029367.1-589s21c1
Sequence:CCGGTCGTCTGTGCCATGAAGATAGCTCGAGCTATCTTCATGGCACAGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029367.1-420s21c1
Sequence:CCGGACAAGTGGCTTCAACACAAATCTCGAGATTTGTGTTGAAGCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029367
SPACA3 MISSION shRNA Lentiviral Transduction Particles
sperm acrosome associated 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000253240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029367.1-543s21c1
Sequence:CCGGAGGATATACTGCACTGATTTGCTCGAGCAAATCAGTGCAGTATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029367.1-457s21c1
Sequence:CCGGCTGATGGAAGCACCAACAATGCTCGAGCATTGTTGGTGCTTCCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029367.1-589s21c1
Sequence:CCGGTCGTCTGTGCCATGAAGATAGCTCGAGCTATCTTCATGGCACAGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029367.1-420s21c1
Sequence:CCGGACAAGTGGCTTCAACACAAATCTCGAGATTTGTGTTGAAGCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks