EMAIL THIS PAGE TO A FRIEND

SPACA4

sperm acrosome associated 4

Synonyms: SAMP14
UniProtKB ID: Q8TDM5
Gene ID:
Mouse(69363) sperm acrosome associated 4
Rat(691120) sperm acrosome associated 4
dog(610505) sperm acrosome associated 4
naked mole-rat(101723216) sperm acrosome associated 4
cow(767953) sperm acrosome associated 4
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027055 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027055 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027055 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133498 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133498 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133498 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133498 Rosetta Predictions human pricing
NM_001109623 Rosetta Predictions rat pricing
NM_027055 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016606 predicted 315
2 SASI_Hs01_00016607 predicted 474
3 SASI_Hs01_00016608 predicted 394
4 SASI_Hs01_00016609 predicted 328
5 SASI_Hs01_00016610 predicted 288
6 SASI_Hs01_00016612 predicted 355
7 SASI_Hs01_00016613 predicted 323
8 SASI_Hs01_00016614 predicted 354
9 SASI_Hs02_00363226 predicted 288
10 SASI_Hs02_00363227 predicted 342
11 SASI_Hs01_00016611 predicted 691
12 SASI_Hs01_00016615 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109623 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250182 predicted 422
2 SASI_Rn02_00250183 predicted 429
3 SASI_Rn02_00250184 predicted 221
4 SASI_Rn02_00250185 predicted 242
5 SASI_Rn02_00250186 predicted 377
6 SASI_Rn02_00250187 predicted 450
7 SASI_Rn02_00250188 predicted 415
8 SASI_Rn02_00250189 predicted 408
9 SASI_Rn02_00250190 predicted 446
10 SASI_Rn02_00250191 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027055 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119128 predicted 440
2 SASI_Mm01_00119129 predicted 246
3 SASI_Mm01_00119130 predicted 282
4 SASI_Mm01_00119131 predicted 286
5 SASI_Mm01_00119132 predicted 461
6 SASI_Mm01_00119133 predicted 429
7 SASI_Mm01_00119134 predicted 448
8 SASI_Mm01_00119135 predicted 431
9 SASI_Mm01_00119136 predicted 266
10 SASI_Mm01_00119137 predicted 414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027055
SPACA4 MISSION shRNA Bacterial Glycerol Stock
sperm acrosome associated 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027055.2-287s21c1
Sequence:CCGGGCATCAAGGACTGCGTCTTCTCTCGAGAGAAGACGCAGTCCTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027055.2-450s21c1
Sequence:CCGGCGAGGAACCCATCAGCTACATCTCGAGATGTAGCTGATGGGTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027055.2-504s21c1
Sequence:CCGGTTCTGGCCACCTTTGCAATAACTCGAGTTATTGCAAAGGTGGCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027055.2-263s21c1
Sequence:CCGGTGGTTCTTTGCCCAGGTGTGACTCGAGTCACACCTGGGCAAAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027055.2-356s21c1
Sequence:CCGGGGGATGACGAAGATTGCTTCACTCGAGTGAAGCAATCTTCGTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027055
SPACA4 MISSION shRNA shRNA Plasmid DNA
sperm acrosome associated 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027055.2-287s21c1
Sequence:CCGGGCATCAAGGACTGCGTCTTCTCTCGAGAGAAGACGCAGTCCTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027055.2-450s21c1
Sequence:CCGGCGAGGAACCCATCAGCTACATCTCGAGATGTAGCTGATGGGTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027055.2-504s21c1
Sequence:CCGGTTCTGGCCACCTTTGCAATAACTCGAGTTATTGCAAAGGTGGCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027055.2-263s21c1
Sequence:CCGGTGGTTCTTTGCCCAGGTGTGACTCGAGTCACACCTGGGCAAAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027055.2-356s21c1
Sequence:CCGGGGGATGACGAAGATTGCTTCACTCGAGTGAAGCAATCTTCGTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027055
SPACA4 MISSION shRNA Lentiviral Transduction Particles
sperm acrosome associated 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027055.2-287s21c1
Sequence:CCGGGCATCAAGGACTGCGTCTTCTCTCGAGAGAAGACGCAGTCCTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027055.2-450s21c1
Sequence:CCGGCGAGGAACCCATCAGCTACATCTCGAGATGTAGCTGATGGGTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027055.2-504s21c1
Sequence:CCGGTTCTGGCCACCTTTGCAATAACTCGAGTTATTGCAAAGGTGGCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027055.2-263s21c1
Sequence:CCGGTGGTTCTTTGCCCAGGTGTGACTCGAGTCACACCTGGGCAAAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027055.2-356s21c1
Sequence:CCGGGGGATGACGAAGATTGCTTCACTCGAGTGAAGCAATCTTCGTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133498
SPACA4 MISSION shRNA Bacterial Glycerol Stock
sperm acrosome associated 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133498.2-406s21c1
Sequence:CCGGCTGGTCCGGTCATCAACAAAGCTCGAGCTTTGTTGATGACCGGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133498.2-723s21c1
Sequence:CCGGCCTGGCTTCATCCCTTCTAAGCTCGAGCTTAGAAGGGATGAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133498.2-454s21c1
Sequence:CCGGTTGAGGAACCCGTCAGCTACACTCGAGTGTAGCTGACGGGTTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133498.2-585s21c1
Sequence:CCGGATGCTGCTTCCTCCACGTTTGCTCGAGCAAACGTGGAGGAAGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133498.2-348s21c1
Sequence:CCGGTACATGCACTGTGGCGATGACCTCGAGGTCATCGCCACAGTGCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133498
SPACA4 MISSION shRNA shRNA Plasmid DNA
sperm acrosome associated 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133498.2-406s21c1
Sequence:CCGGCTGGTCCGGTCATCAACAAAGCTCGAGCTTTGTTGATGACCGGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133498.2-723s21c1
Sequence:CCGGCCTGGCTTCATCCCTTCTAAGCTCGAGCTTAGAAGGGATGAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133498.2-454s21c1
Sequence:CCGGTTGAGGAACCCGTCAGCTACACTCGAGTGTAGCTGACGGGTTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133498.2-585s21c1
Sequence:CCGGATGCTGCTTCCTCCACGTTTGCTCGAGCAAACGTGGAGGAAGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133498.2-348s21c1
Sequence:CCGGTACATGCACTGTGGCGATGACCTCGAGGTCATCGCCACAGTGCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133498
SPACA4 MISSION shRNA Lentiviral Transduction Particles
sperm acrosome associated 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133498.2-406s21c1
Sequence:CCGGCTGGTCCGGTCATCAACAAAGCTCGAGCTTTGTTGATGACCGGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133498.2-723s21c1
Sequence:CCGGCCTGGCTTCATCCCTTCTAAGCTCGAGCTTAGAAGGGATGAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133498.2-454s21c1
Sequence:CCGGTTGAGGAACCCGTCAGCTACACTCGAGTGTAGCTGACGGGTTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133498.2-585s21c1
Sequence:CCGGATGCTGCTTCCTCCACGTTTGCTCGAGCAAACGTGGAGGAAGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133498.2-348s21c1
Sequence:CCGGTACATGCACTGTGGCGATGACCTCGAGGTCATCGCCACAGTGCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks