EMAIL THIS PAGE TO A FRIEND

SPACA5

sperm acrosome associated 5

Synonyms: LYC5 LYZL5 PNPK6288 SLLP-X SLLP2 UNQ6288
UniProtKB ID: Q96QH8, Q6UWD1
Gene ID:
Mouse(278203) sperm acrosome associated 5
Rat(314431) sperm acrosome associated 5
cow(517880) sperm acrosome associated 5
sheep(101115856) sperm acrosome associated 5
domestic guinea pig(100715191) sperm acrosome associated 5
dog(480901) sperm acrosome associated 5
domestic cat(101091348) sperm acrosome associated 5
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_205856 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_205856 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_205856 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001085393 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085393 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085393 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_205301 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_205301 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_205301 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_205856 Rosetta Predictions human pricing
NM_001108058 Rosetta Predictions rat pricing
NM_001085393 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201287 predicted 220
2 SASI_Hs01_00201288 predicted 311
3 SASI_Hs02_00373496 predicted 211
4 SASI_Hs01_00201289 predicted 325
5 SASI_Hs01_00201290 predicted 512
6 SASI_Hs01_00201291 predicted 368
7 SASI_Hs01_00201292 predicted 453
8 SASI_Hs02_00373497 predicted 466
9 SASI_Hs01_00201296 predicted 477
10 SASI_Hs02_00373498 predicted 363
11 SASI_Hs01_00201293 predicted 431
12 SASI_Hs01_00201294 predicted 208
13 SASI_Hs01_00201295 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108058 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234935 predicted 288
2 SASI_Rn02_00234936 predicted 282
3 SASI_Rn02_00234937 predicted 314
4 SASI_Rn02_00234938 predicted 237
5 SASI_Rn02_00234939 predicted 301
6 SASI_Rn02_00234940 predicted 280
7 SASI_Rn02_00234941 predicted 274
8 SASI_Rn02_00234942 predicted 312
9 SASI_Rn02_00234943 predicted 298
10 SASI_Rn02_00234944 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300315 predicted 226
2 SASI_Mm02_00300316 predicted 393
3 SASI_Mm02_00300317 predicted 236
4 SASI_Mm02_00300318 predicted 398
5 SASI_Mm02_00300319 predicted 277
6 SASI_Mm02_00300320 predicted 367
7 SASI_Mm02_00300321 predicted 391
8 SASI_Mm02_00300322 predicted 380
9 SASI_Mm02_00300323 predicted 281
10 SASI_Mm02_00300324 predicted 357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_205856
SPACA5 MISSION shRNA Bacterial Glycerol Stock
sperm acrosome associated 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205856.2-447s21c1
Sequence:CCGGGAACCTCTGCCACATGGATTGCTCGAGCAATCCATGTGGCAGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205856.2-416s21c1
Sequence:CCGGGGTGGTGTGACAATGGCATTACTCGAGTAATGCCATTGTCACACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205856.1-377s1c1
Sequence:CCGGGCAGCAGTGAATATGGCATTTCTCGAGAAATGCCATATTCACTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205856.1-325s1c1
Sequence:CCGGGCTCATTATGAGAGTGGCTTTCTCGAGAAAGCCACTCTCATAATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205856.1-516s1c1
Sequence:CCGGGCAGATTGTGTCCTCACAGAACTCGAGTTCTGTGAGGACACAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205856.1-472s1c1
Sequence:CCGGGACCTGCTCAATCGCCATATTCTCGAGAATATGGCGATTGAGCAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205856.1-579s1c1
Sequence:CCGGCCATGATTTATCTGAATGGCTCTCGAGAGCCATTCAGATAAATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_205856
SPACA5 MISSION shRNA shRNA Plasmid DNA
sperm acrosome associated 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205856.2-447s21c1
Sequence:CCGGGAACCTCTGCCACATGGATTGCTCGAGCAATCCATGTGGCAGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205856.2-416s21c1
Sequence:CCGGGGTGGTGTGACAATGGCATTACTCGAGTAATGCCATTGTCACACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205856.1-377s1c1
Sequence:CCGGGCAGCAGTGAATATGGCATTTCTCGAGAAATGCCATATTCACTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205856.1-325s1c1
Sequence:CCGGGCTCATTATGAGAGTGGCTTTCTCGAGAAAGCCACTCTCATAATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205856.1-516s1c1
Sequence:CCGGGCAGATTGTGTCCTCACAGAACTCGAGTTCTGTGAGGACACAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205856.1-472s1c1
Sequence:CCGGGACCTGCTCAATCGCCATATTCTCGAGAATATGGCGATTGAGCAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205856.1-579s1c1
Sequence:CCGGCCATGATTTATCTGAATGGCTCTCGAGAGCCATTCAGATAAATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_205856
SPACA5 MISSION shRNA Lentiviral Transduction Particles
sperm acrosome associated 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205856.2-447s21c1
Sequence:CCGGGAACCTCTGCCACATGGATTGCTCGAGCAATCCATGTGGCAGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205856.2-416s21c1
Sequence:CCGGGGTGGTGTGACAATGGCATTACTCGAGTAATGCCATTGTCACACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205856.1-377s1c1
Sequence:CCGGGCAGCAGTGAATATGGCATTTCTCGAGAAATGCCATATTCACTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205856.1-325s1c1
Sequence:CCGGGCTCATTATGAGAGTGGCTTTCTCGAGAAAGCCACTCTCATAATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205856.1-516s1c1
Sequence:CCGGGCAGATTGTGTCCTCACAGAACTCGAGTTCTGTGAGGACACAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205856.1-472s1c1
Sequence:CCGGGACCTGCTCAATCGCCATATTCTCGAGAATATGGCGATTGAGCAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205856.1-579s1c1
Sequence:CCGGCCATGATTTATCTGAATGGCTCTCGAGAGCCATTCAGATAAATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085393
SPACA5 MISSION shRNA Bacterial Glycerol Stock
sperm acrosome associated 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085393.1-437s21c1
Sequence:CCGGGCATCCTCACATAAGAGTATGCTCGAGCATACTCTTATGTGAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085393.1-386s21c1
Sequence:CCGGGACCTGCTCAACCGCCATATTCTCGAGAATATGGCGGTTGAGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085393.1-361s21c1
Sequence:CCGGGAACCTCTGCAACATCGATTGCTCGAGCAATCGATGTTGCAGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001085393.1-437s1c1
Sequence:CCGGGCATCCTCACATAAGAGTATGCTCGAGCATACTCTTATGTGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001085393.1-398s1c1
Sequence:CCGGCGCCATATTCTGGATGATATCCTCGAGGATATCATCCAGAATATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085393.1-133s21c1
Sequence:CCGGCAAATTGGATGCCAAGATTTACTCGAGTAAATCTTGGCATCCAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085393.1-195s21c1
Sequence:CCGGTCGATGGCTTCAAAGGCTATACTCGAGTATAGCCTTTGAAGCCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085393
SPACA5 MISSION shRNA shRNA Plasmid DNA
sperm acrosome associated 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085393.1-437s21c1
Sequence:CCGGGCATCCTCACATAAGAGTATGCTCGAGCATACTCTTATGTGAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085393.1-386s21c1
Sequence:CCGGGACCTGCTCAACCGCCATATTCTCGAGAATATGGCGGTTGAGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085393.1-361s21c1
Sequence:CCGGGAACCTCTGCAACATCGATTGCTCGAGCAATCGATGTTGCAGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001085393.1-437s1c1
Sequence:CCGGGCATCCTCACATAAGAGTATGCTCGAGCATACTCTTATGTGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001085393.1-398s1c1
Sequence:CCGGCGCCATATTCTGGATGATATCCTCGAGGATATCATCCAGAATATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085393.1-133s21c1
Sequence:CCGGCAAATTGGATGCCAAGATTTACTCGAGTAAATCTTGGCATCCAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085393.1-195s21c1
Sequence:CCGGTCGATGGCTTCAAAGGCTATACTCGAGTATAGCCTTTGAAGCCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085393
SPACA5 MISSION shRNA Lentiviral Transduction Particles
sperm acrosome associated 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085393.1-437s21c1
Sequence:CCGGGCATCCTCACATAAGAGTATGCTCGAGCATACTCTTATGTGAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085393.1-386s21c1
Sequence:CCGGGACCTGCTCAACCGCCATATTCTCGAGAATATGGCGGTTGAGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085393.1-361s21c1
Sequence:CCGGGAACCTCTGCAACATCGATTGCTCGAGCAATCGATGTTGCAGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001085393.1-437s1c1
Sequence:CCGGGCATCCTCACATAAGAGTATGCTCGAGCATACTCTTATGTGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001085393.1-398s1c1
Sequence:CCGGCGCCATATTCTGGATGATATCCTCGAGGATATCATCCAGAATATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085393.1-133s21c1
Sequence:CCGGCAAATTGGATGCCAAGATTTACTCGAGTAAATCTTGGCATCCAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085393.1-195s21c1
Sequence:CCGGTCGATGGCTTCAAAGGCTATACTCGAGTATAGCCTTTGAAGCCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_205301
SPACA5 MISSION shRNA Bacterial Glycerol Stock
sperm acrosome associated 5
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000204811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_205301.1-168s1c1
Sequence:CCGGGAGTGGCTTTGACACCTCTTTCTCGAGAAAGAGGTGTCAAAGCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_205301.1-34s1c1
Sequence:CCGGGCCGTATTGTTGATTGCCAAACTCGAGTTTGGCAATCAACAATACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_205301.1-294s1c1
Sequence:CCGGCGATTGTAATGACCTGCTCAACTCGAGTTGAGCAGGTCATTACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_205301
SPACA5 MISSION shRNA shRNA Plasmid DNA
sperm acrosome associated 5
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000204811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_205301.1-168s1c1
Sequence:CCGGGAGTGGCTTTGACACCTCTTTCTCGAGAAAGAGGTGTCAAAGCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_205301.1-34s1c1
Sequence:CCGGGCCGTATTGTTGATTGCCAAACTCGAGTTTGGCAATCAACAATACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_205301.1-294s1c1
Sequence:CCGGCGATTGTAATGACCTGCTCAACTCGAGTTGAGCAGGTCATTACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_205301
SPACA5 MISSION shRNA Lentiviral Transduction Particles
sperm acrosome associated 5
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000204811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_205301.1-168s1c1
Sequence:CCGGGAGTGGCTTTGACACCTCTTTCTCGAGAAAGAGGTGTCAAAGCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_205301.1-34s1c1
Sequence:CCGGGCCGTATTGTTGATTGCCAAACTCGAGTTTGGCAATCAACAATACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_205301.1-294s1c1
Sequence:CCGGCGATTGTAATGACCTGCTCAACTCGAGTTGAGCAGGTCATTACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks