EMAIL THIS PAGE TO A FRIEND

SPACA5B

sperm acrosome associated 5B

Species: Human SPACA5B(729201)
Gene ID:
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001079900 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001079900 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001079900 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106671 MISSION® esiRNA esiRNA human SPACA5B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079900 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314090 predicted 367
2 SASI_Hs02_00314091 predicted 318
3 SASI_Hs02_00314092 predicted 309
4 SASI_Hs02_00314093 predicted 336
5 SASI_Hs02_00314094 predicted 269
6 SASI_Hs02_00314095 predicted 328
7 SASI_Hs02_00314096 predicted 307
8 SASI_Hs02_00314097 predicted 331
9 SASI_Hs02_00314098 predicted 342
10 SASI_Hs02_00314099 predicted 368
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001079900
SPACA5B MISSION shRNA Bacterial Glycerol Stock
sperm acrosome associated 5B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079900.1-176s21c1
Sequence:CCGGTGGCTGTGCATGGCTCATTATCTCGAGATAATGAGCCATGCACAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079900.1-232s21c1
Sequence:CCGGTCCTGATGGCAGCAGTGAATACTCGAGTATTCACTGCTGCCATCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079900.1-336s21c1
Sequence:CCGGACCTGCTCAATCGCCATATTCCTCGAGGAATATGGCGATTGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079900.1-84s21c1
Sequence:CCGGCTGTGGATGCCAAGATCTATGCTCGAGCATAGATCTTGGCATCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079900.1-381s21c1
Sequence:CCGGAGATTGTGTCCTCACAGAATGCTCGAGCATTCTGTGAGGACACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001079900
SPACA5B MISSION shRNA shRNA Plasmid DNA
sperm acrosome associated 5B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079900.1-176s21c1
Sequence:CCGGTGGCTGTGCATGGCTCATTATCTCGAGATAATGAGCCATGCACAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079900.1-232s21c1
Sequence:CCGGTCCTGATGGCAGCAGTGAATACTCGAGTATTCACTGCTGCCATCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079900.1-336s21c1
Sequence:CCGGACCTGCTCAATCGCCATATTCCTCGAGGAATATGGCGATTGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079900.1-84s21c1
Sequence:CCGGCTGTGGATGCCAAGATCTATGCTCGAGCATAGATCTTGGCATCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079900.1-381s21c1
Sequence:CCGGAGATTGTGTCCTCACAGAATGCTCGAGCATTCTGTGAGGACACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001079900
SPACA5B MISSION shRNA Lentiviral Transduction Particles
sperm acrosome associated 5B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079900.1-176s21c1
Sequence:CCGGTGGCTGTGCATGGCTCATTATCTCGAGATAATGAGCCATGCACAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079900.1-232s21c1
Sequence:CCGGTCCTGATGGCAGCAGTGAATACTCGAGTATTCACTGCTGCCATCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079900.1-336s21c1
Sequence:CCGGACCTGCTCAATCGCCATATTCCTCGAGGAATATGGCGATTGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079900.1-84s21c1
Sequence:CCGGCTGTGGATGCCAAGATCTATGCTCGAGCATAGATCTTGGCATCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079900.1-381s21c1
Sequence:CCGGAGATTGTGTCCTCACAGAATGCTCGAGCATTCTGTGAGGACACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks