EMAIL THIS PAGE TO A FRIEND

SPACA7

sperm acrosome associated 7

Synonyms: C13orf28
UniProtKB ID: Q96KW9, Q5T8L1
Gene ID:
Mouse(78634) sperm acrosome associated 7
Rat(689077) sperm acrosome associated 7
cow(781940) sperm acrosome associated 7
39 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2105705 Anti-C13ORF28 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024279 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024279 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024279 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145248 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145248 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145248 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032031 MISSION® esiRNA esiRNA human C13orf28 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145248 Rosetta Predictions human pricing
XM_001069425 Rosetta Predictions rat pricing
NM_024279 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159033 predicted 266
2 SASI_Hs01_00159034 predicted 374
3 SASI_Hs02_00365090 predicted 289
4 SASI_Hs01_00159035 predicted 406
5 SASI_Hs01_00159036 predicted 483
6 SASI_Hs01_00159037 predicted 297
7 SASI_Hs01_00159038 predicted 455
8 SASI_Hs01_00159040 predicted 258
9 SASI_Hs02_00365091 predicted 318
10 SASI_Hs01_00159041 predicted 443
11 SASI_Hs01_00159039 predicted 304
12 SASI_Hs01_00159042 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069425 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327975 predicted 334
2 SASI_Rn02_00327976 predicted 300
3 SASI_Rn02_00327977 predicted 287
4 SASI_Rn02_00327978 predicted 269
5 SASI_Rn02_00327979 predicted 210
6 SASI_Rn02_00327980 predicted 195
7 SASI_Rn02_00327981 predicted 308
8 SASI_Rn02_00327982 predicted 248
9 SASI_Rn02_00327983 predicted 245
10 SASI_Rn02_00327984 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193430 predicted 273
2 SASI_Mm01_00193431 predicted 264
3 SASI_Mm01_00193432 predicted 302
4 SASI_Mm01_00193433 predicted 334
5 SASI_Mm01_00193434 predicted 278
6 SASI_Mm01_00193435 predicted 347
7 SASI_Mm01_00193436 predicted 524
8 SASI_Mm01_00193438 predicted 428
9 SASI_Mm02_00327697 predicted 496
10 SASI_Mm01_00193439 predicted 420
11 SASI_Mm01_00193437 predicted 347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024279
SPACA7 MISSION shRNA Bacterial Glycerol Stock
sperm acrosome associated 7
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024279.2-140s21c1
Sequence:CCGGAGACAACTTCAGGTCCAATTACTCGAGTAATTGGACCTGAAGTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024279.2-195s21c1
Sequence:CCGGACCCGAAGCATTAGATGAAATCTCGAGATTTCATCTAATGCTTCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024279.2-141s1c1
Sequence:CCGGGACAACTTCAGGTCCAATTACCTCGAGGTAATTGGACCTGAAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024279.2-163s1c1
Sequence:CCGGGAAGGTTCACTCAACTCAACACTCGAGTGTTGAGTTGAGTGAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024279.2-421s21c1
Sequence:CCGGGACAGAAGCACGGTTGCAAACCTCGAGGTTTGCAACCGTGCTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024279.1-251s1c1
Sequence:CCGGGCAGTGTCTGAAACATCACCACTCGAGTGGTGATGTTTCAGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024279.1-389s1c1
Sequence:CCGGCACTTGCCTACAAAGGAGGAACTCGAGTTCCTCCTTTGTAGGCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024279.1-526s1c1
Sequence:CCGGGAAACTGTCTGTTCTGGACAACTCGAGTTGTCCAGAACAGACAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024279.1-269s1c1
Sequence:CCGGCCACGACCAAGATCATCGATACTCGAGTATCGATGATCTTGGTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024279.1-580s1c1
Sequence:CCGGCCTGGAGCTAACAGAAAGCATCTCGAGATGCTTTCTGTTAGCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024279.1-584s1c1
Sequence:CCGGGAGCTAACAGAAAGCATCTTTCTCGAGAAAGATGCTTTCTGTTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024279
SPACA7 MISSION shRNA shRNA Plasmid DNA
sperm acrosome associated 7
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024279.2-140s21c1
Sequence:CCGGAGACAACTTCAGGTCCAATTACTCGAGTAATTGGACCTGAAGTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024279.2-195s21c1
Sequence:CCGGACCCGAAGCATTAGATGAAATCTCGAGATTTCATCTAATGCTTCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024279.2-141s1c1
Sequence:CCGGGACAACTTCAGGTCCAATTACCTCGAGGTAATTGGACCTGAAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024279.2-163s1c1
Sequence:CCGGGAAGGTTCACTCAACTCAACACTCGAGTGTTGAGTTGAGTGAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024279.2-421s21c1
Sequence:CCGGGACAGAAGCACGGTTGCAAACCTCGAGGTTTGCAACCGTGCTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024279.1-251s1c1
Sequence:CCGGGCAGTGTCTGAAACATCACCACTCGAGTGGTGATGTTTCAGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024279.1-389s1c1
Sequence:CCGGCACTTGCCTACAAAGGAGGAACTCGAGTTCCTCCTTTGTAGGCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024279.1-526s1c1
Sequence:CCGGGAAACTGTCTGTTCTGGACAACTCGAGTTGTCCAGAACAGACAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024279.1-269s1c1
Sequence:CCGGCCACGACCAAGATCATCGATACTCGAGTATCGATGATCTTGGTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024279.1-580s1c1
Sequence:CCGGCCTGGAGCTAACAGAAAGCATCTCGAGATGCTTTCTGTTAGCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024279.1-584s1c1
Sequence:CCGGGAGCTAACAGAAAGCATCTTTCTCGAGAAAGATGCTTTCTGTTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024279
SPACA7 MISSION shRNA Lentiviral Transduction Particles
sperm acrosome associated 7
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024279.2-140s21c1
Sequence:CCGGAGACAACTTCAGGTCCAATTACTCGAGTAATTGGACCTGAAGTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024279.2-195s21c1
Sequence:CCGGACCCGAAGCATTAGATGAAATCTCGAGATTTCATCTAATGCTTCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024279.2-141s1c1
Sequence:CCGGGACAACTTCAGGTCCAATTACCTCGAGGTAATTGGACCTGAAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024279.2-163s1c1
Sequence:CCGGGAAGGTTCACTCAACTCAACACTCGAGTGTTGAGTTGAGTGAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024279.2-421s21c1
Sequence:CCGGGACAGAAGCACGGTTGCAAACCTCGAGGTTTGCAACCGTGCTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024279.1-251s1c1
Sequence:CCGGGCAGTGTCTGAAACATCACCACTCGAGTGGTGATGTTTCAGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024279.1-389s1c1
Sequence:CCGGCACTTGCCTACAAAGGAGGAACTCGAGTTCCTCCTTTGTAGGCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024279.1-526s1c1
Sequence:CCGGGAAACTGTCTGTTCTGGACAACTCGAGTTGTCCAGAACAGACAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024279.1-269s1c1
Sequence:CCGGCCACGACCAAGATCATCGATACTCGAGTATCGATGATCTTGGTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024279.1-580s1c1
Sequence:CCGGCCTGGAGCTAACAGAAAGCATCTCGAGATGCTTTCTGTTAGCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024279.1-584s1c1
Sequence:CCGGGAGCTAACAGAAAGCATCTTTCTCGAGAAAGATGCTTTCTGTTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145248
SPACA7 MISSION shRNA Bacterial Glycerol Stock
sperm acrosome associated 7
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-82s1c1
Sequence:CCGGCTGTTGGCAAGAAACTGAGCTCTCGAGAGCTCAGTTTCTTGCCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-231s1c1
Sequence:CCGGGCGAAATGCCAAGTACAGCATCTCGAGATGCTGTACTTGGCATTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145248.2-396s1c1
Sequence:CCGGCAAATCTCCATGGCGATCCTTCTCGAGAAGGATCGCCATGGAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-408s1c1
Sequence:CCGGGCGATCCTTCTGAGAATTATCCTCGAGGATAATTCTCAGAAGGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-372s1c1
Sequence:CCGGCCAATGATGAAGCCAATGCTACTCGAGTAGCATTGGCTTCATCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145248.2-126s1c1
Sequence:CCGGGTTCACCTACTGAAATACCATCTCGAGATGGTATTTCAGTAGGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145248.2-457s1c1
Sequence:CCGGGAAGAGTGTTTCCAGTAAAGACTCGAGTCTTTACTGGAAACACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-131s1c1
Sequence:CCGGCCTACTGAAATACCATTCAGTCTCGAGACTGAATGGTATTTCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-238s1c1
Sequence:CCGGGCCAAGTACAGCATCAACATTCTCGAGAATGTTGATGCTGTACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145248.2-287s1c1
Sequence:CCGGGAGAATTATCAAGCTGGTGGTCTCGAGACCACCAGCTTGATAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-447s1c1
Sequence:CCGGCTGGCAGTGAGAAGAGTGTTTCTCGAGAAACACTCTTCTCACTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145248.2-261s1c1
Sequence:CCGGCAACACCGTTACATGCTGGTACTCGAGTACCAGCATGTAACGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-118s1c1
Sequence:CCGGGATTCCAGGTTCACCTACTGACTCGAGTCAGTAGGTGAACCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145248
SPACA7 MISSION shRNA shRNA Plasmid DNA
sperm acrosome associated 7
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-82s1c1
Sequence:CCGGCTGTTGGCAAGAAACTGAGCTCTCGAGAGCTCAGTTTCTTGCCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-231s1c1
Sequence:CCGGGCGAAATGCCAAGTACAGCATCTCGAGATGCTGTACTTGGCATTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145248.2-396s1c1
Sequence:CCGGCAAATCTCCATGGCGATCCTTCTCGAGAAGGATCGCCATGGAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-408s1c1
Sequence:CCGGGCGATCCTTCTGAGAATTATCCTCGAGGATAATTCTCAGAAGGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-372s1c1
Sequence:CCGGCCAATGATGAAGCCAATGCTACTCGAGTAGCATTGGCTTCATCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145248.2-126s1c1
Sequence:CCGGGTTCACCTACTGAAATACCATCTCGAGATGGTATTTCAGTAGGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145248.2-457s1c1
Sequence:CCGGGAAGAGTGTTTCCAGTAAAGACTCGAGTCTTTACTGGAAACACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-131s1c1
Sequence:CCGGCCTACTGAAATACCATTCAGTCTCGAGACTGAATGGTATTTCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-238s1c1
Sequence:CCGGGCCAAGTACAGCATCAACATTCTCGAGAATGTTGATGCTGTACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145248.2-287s1c1
Sequence:CCGGGAGAATTATCAAGCTGGTGGTCTCGAGACCACCAGCTTGATAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-447s1c1
Sequence:CCGGCTGGCAGTGAGAAGAGTGTTTCTCGAGAAACACTCTTCTCACTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145248.2-261s1c1
Sequence:CCGGCAACACCGTTACATGCTGGTACTCGAGTACCAGCATGTAACGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-118s1c1
Sequence:CCGGGATTCCAGGTTCACCTACTGACTCGAGTCAGTAGGTGAACCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145248
SPACA7 MISSION shRNA Lentiviral Transduction Particles
sperm acrosome associated 7
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-82s1c1
Sequence:CCGGCTGTTGGCAAGAAACTGAGCTCTCGAGAGCTCAGTTTCTTGCCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-231s1c1
Sequence:CCGGGCGAAATGCCAAGTACAGCATCTCGAGATGCTGTACTTGGCATTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145248.2-396s1c1
Sequence:CCGGCAAATCTCCATGGCGATCCTTCTCGAGAAGGATCGCCATGGAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-408s1c1
Sequence:CCGGGCGATCCTTCTGAGAATTATCCTCGAGGATAATTCTCAGAAGGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-372s1c1
Sequence:CCGGCCAATGATGAAGCCAATGCTACTCGAGTAGCATTGGCTTCATCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145248.2-126s1c1
Sequence:CCGGGTTCACCTACTGAAATACCATCTCGAGATGGTATTTCAGTAGGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145248.2-457s1c1
Sequence:CCGGGAAGAGTGTTTCCAGTAAAGACTCGAGTCTTTACTGGAAACACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-131s1c1
Sequence:CCGGCCTACTGAAATACCATTCAGTCTCGAGACTGAATGGTATTTCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-238s1c1
Sequence:CCGGGCCAAGTACAGCATCAACATTCTCGAGAATGTTGATGCTGTACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145248.2-287s1c1
Sequence:CCGGGAGAATTATCAAGCTGGTGGTCTCGAGACCACCAGCTTGATAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-447s1c1
Sequence:CCGGCTGGCAGTGAGAAGAGTGTTTCTCGAGAAACACTCTTCTCACTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145248.2-261s1c1
Sequence:CCGGCAACACCGTTACATGCTGGTACTCGAGTACCAGCATGTAACGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145248.2-118s1c1
Sequence:CCGGGATTCCAGGTTCACCTACTGACTCGAGTCAGTAGGTGAACCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks