EMAIL THIS PAGE TO A FRIEND

SPAG11A

sperm associated antigen 11A

Synonyms: EDDM2A HE2
UniProtKB ID: Q6PDA7, A6NIY0
Gene ID:
Mouse(78128) sperm associated antigen 11A
124 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081552 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001081552 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001081552 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153115 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153115 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153115 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001081552 Rosetta Predictions human pricing
XM_001713749 Rosetta Predictions human pricing
XM_929074 Rosetta Predictions human pricing
XM_933395 Rosetta Predictions human pricing
XM_933397 Rosetta Predictions human pricing
XM_933402 Rosetta Predictions human pricing
XM_933404 Rosetta Predictions human pricing
XM_933407 Rosetta Predictions human pricing
XM_933412 Rosetta Predictions human pricing
XM_933416 Rosetta Predictions human pricing
NM_153115 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316413 predicted 417
2 SASI_Hs02_00316414 predicted 323
3 SASI_Hs02_00316415 predicted 466
4 SASI_Hs02_00316416 predicted 478
5 SASI_Hs02_00316417 predicted 321
6 SASI_Hs02_00316418 predicted 394
7 SASI_Hs02_00316419 predicted 408
8 SASI_Hs02_00316420 predicted 299
9 SASI_Hs02_00316421 predicted 513
10 SASI_Hs02_00316422 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00392939 predicted 260
2 SASI_Hs02_00392940 predicted 259
3 SASI_Hs02_00392941 predicted 203
4 SASI_Hs02_00392942 predicted 254
5 SASI_Hs02_00392943 predicted 259
6 SASI_Hs02_00392944 predicted 307
7 SASI_Hs02_00392945 predicted 264
8 SASI_Hs02_00392946 predicted 259
9 SASI_Hs02_00392947 predicted 232
10 SASI_Hs02_00392948 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272132 predicted 315
2 SASI_Hs01_00272133 predicted 329
3 SASI_Hs01_00272134 predicted 203
4 SASI_Hs01_00272135 predicted 253
5 SASI_Hs01_00272136 predicted 320
6 SASI_Hs01_00272137 predicted 266
7 SASI_Hs01_00272138 predicted 300
8 SASI_Hs01_00272139 predicted 263
9 SASI_Hs01_00272140 predicted 258
10 SASI_Hs01_00272141 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263570 predicted 260
2 SASI_Hs01_00263571 predicted 237
3 SASI_Hs01_00263572 predicted 393
4 SASI_Hs01_00263573 predicted 382
5 SASI_Hs01_00263574 predicted 392
6 SASI_Hs01_00263575 predicted 208
7 SASI_Hs01_00263576 predicted 225
8 SASI_Hs01_00263577 predicted 288
9 SASI_Hs01_00263578 predicted 431
10 SASI_Hs01_00263579 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265831 predicted 376
2 SASI_Hs01_00265832 predicted 418
3 SASI_Hs01_00265833 predicted 319
4 SASI_Hs01_00265834 predicted 474
5 SASI_Hs01_00265835 predicted 254
6 SASI_Hs01_00265836 predicted 481
7 SASI_Hs01_00265837 predicted 393
8 SASI_Hs01_00265838 predicted 411
9 SASI_Hs01_00265839 predicted 244
10 SASI_Hs01_00265840 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270618 predicted 213
2 SASI_Hs01_00270619 predicted 341
3 SASI_Hs01_00270620 predicted 338
4 SASI_Hs01_00270621 predicted 230
5 SASI_Hs01_00270622 predicted 391
6 SASI_Hs01_00270623 predicted 345
7 SASI_Hs01_00270624 predicted 348
8 SASI_Hs01_00270625 predicted 237
9 SASI_Hs01_00270626 predicted 242
10 SASI_Hs01_00270627 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279874 predicted 377
2 SASI_Hs01_00279875 predicted 375
3 SASI_Hs01_00279876 predicted 374
4 SASI_Hs01_00279877 predicted 320
5 SASI_Hs01_00279878 predicted 252
6 SASI_Hs01_00279879 predicted 321
7 SASI_Hs01_00279880 predicted 236
8 SASI_Hs01_00279881 predicted 254
9 SASI_Hs01_00279882 predicted 306
10 SASI_Hs01_00279883 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255215 predicted 321
2 SASI_Hs01_00255216 predicted 389
3 SASI_Hs01_00255217 predicted 252
4 SASI_Hs01_00255218 predicted 399
5 SASI_Hs01_00255219 predicted 316
6 SASI_Hs01_00255220 predicted 305
7 SASI_Hs01_00255221 predicted 239
8 SASI_Hs01_00255222 predicted 245
9 SASI_Hs01_00255223 predicted 297
10 SASI_Hs01_00255224 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266772 predicted 394
2 SASI_Hs01_00266773 predicted 314
3 SASI_Hs01_00266774 predicted 324
4 SASI_Hs01_00266775 predicted 211
5 SASI_Hs01_00266776 predicted 397
6 SASI_Hs01_00266777 predicted 250
7 SASI_Hs01_00266778 predicted 263
8 SASI_Hs01_00266779 predicted 300
9 SASI_Hs01_00266780 predicted 362
10 SASI_Hs01_00266781 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263052 predicted 117
2 SASI_Hs01_00263053 predicted 227
3 SASI_Hs01_00263054 predicted 127
4 SASI_Hs01_00263055 predicted 179
5 SASI_Hs01_00263056 predicted 217
6 SASI_Hs01_00263057 predicted 127
7 SASI_Hs01_00263058 predicted 202
8 SASI_Hs01_00263059 predicted 208
9 SASI_Hs01_00263060 predicted 294
10 SASI_Hs01_00263061 predicted 102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153115 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181267 predicted 114
2 SASI_Mm01_00181268 predicted 274
3 SASI_Mm01_00181269 predicted 62
4 SASI_Mm01_00181270 predicted 270
5 SASI_Mm01_00181271 predicted 334
6 SASI_Mm01_00181272 predicted 374
7 SASI_Mm01_00181273 predicted 115
8 SASI_Mm01_00181274 predicted 57
9 SASI_Mm01_00181275 predicted 157
10 SASI_Mm01_00181276 predicted 63
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081552
SPAG11A MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 11A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081552.2-523s21c1
Sequence:CCGGCCTGTCTTCTGGAGTTGTGACCTCGAGGTCACAACTCCAGAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081552.2-424s21c1
Sequence:CCGGAGCAAGGGATCTGCAGACTTTCTCGAGAAAGTCTGCAGATCCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081552.2-337s21c1
Sequence:CCGGCAGTGAAACGGGACCTCTTACCTCGAGGTAAGAGGTCCCGTTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081552.2-402s21c1
Sequence:CCGGAGAAATACCATCTGCCGTATGCTCGAGCATACGGCAGATGGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081552.2-475s21c1
Sequence:CCGGACAGACAACGCTGTGGATAAGCTCGAGCTTATCCACAGCGTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081552
SPAG11A MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 11A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081552.2-523s21c1
Sequence:CCGGCCTGTCTTCTGGAGTTGTGACCTCGAGGTCACAACTCCAGAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081552.2-424s21c1
Sequence:CCGGAGCAAGGGATCTGCAGACTTTCTCGAGAAAGTCTGCAGATCCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081552.2-337s21c1
Sequence:CCGGCAGTGAAACGGGACCTCTTACCTCGAGGTAAGAGGTCCCGTTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081552.2-402s21c1
Sequence:CCGGAGAAATACCATCTGCCGTATGCTCGAGCATACGGCAGATGGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081552.2-475s21c1
Sequence:CCGGACAGACAACGCTGTGGATAAGCTCGAGCTTATCCACAGCGTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081552
SPAG11A MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 11A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081552.2-523s21c1
Sequence:CCGGCCTGTCTTCTGGAGTTGTGACCTCGAGGTCACAACTCCAGAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081552.2-424s21c1
Sequence:CCGGAGCAAGGGATCTGCAGACTTTCTCGAGAAAGTCTGCAGATCCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081552.2-337s21c1
Sequence:CCGGCAGTGAAACGGGACCTCTTACCTCGAGGTAAGAGGTCCCGTTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081552.2-402s21c1
Sequence:CCGGAGAAATACCATCTGCCGTATGCTCGAGCATACGGCAGATGGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081552.2-475s21c1
Sequence:CCGGACAGACAACGCTGTGGATAAGCTCGAGCTTATCCACAGCGTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153115
SPAG11A MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 11A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153115.1-126s1c1
Sequence:CCGGCCGGAATCAGAAACACCGTGTCTCGAGACACGGTGTTTCTGATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153115.1-181s1c1
Sequence:CCGGGTGCCGTTCTGGTGAGAGAAACTCGAGTTTCTCTCACCAGAACGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153115.1-168s1c1
Sequence:CCGGGCAGGCTCTTCATGTGCCGTTCTCGAGAACGGCACATGAAGAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153115.1-243s1c1
Sequence:CCGGCCTATTCTGTTAAAGACAGAACTCGAGTTCTGTCTTTAACAGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153115.1-117s1c1
Sequence:CCGGACATCCCACCCGGAATCAGAACTCGAGTTCTGATTCCGGGTGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153115
SPAG11A MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 11A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153115.1-126s1c1
Sequence:CCGGCCGGAATCAGAAACACCGTGTCTCGAGACACGGTGTTTCTGATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153115.1-181s1c1
Sequence:CCGGGTGCCGTTCTGGTGAGAGAAACTCGAGTTTCTCTCACCAGAACGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153115.1-168s1c1
Sequence:CCGGGCAGGCTCTTCATGTGCCGTTCTCGAGAACGGCACATGAAGAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153115.1-243s1c1
Sequence:CCGGCCTATTCTGTTAAAGACAGAACTCGAGTTCTGTCTTTAACAGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153115.1-117s1c1
Sequence:CCGGACATCCCACCCGGAATCAGAACTCGAGTTCTGATTCCGGGTGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153115
SPAG11A MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 11A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153115.1-126s1c1
Sequence:CCGGCCGGAATCAGAAACACCGTGTCTCGAGACACGGTGTTTCTGATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153115.1-181s1c1
Sequence:CCGGGTGCCGTTCTGGTGAGAGAAACTCGAGTTTCTCTCACCAGAACGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153115.1-168s1c1
Sequence:CCGGGCAGGCTCTTCATGTGCCGTTCTCGAGAACGGCACATGAAGAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153115.1-243s1c1
Sequence:CCGGCCTATTCTGTTAAAGACAGAACTCGAGTTCTGTCTTTAACAGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153115.1-117s1c1
Sequence:CCGGACATCCCACCCGGAATCAGAACTCGAGTTCTGATTCCGGGTGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks