EMAIL THIS PAGE TO A FRIEND

SPAG11B

sperm associated antigen 11B

Synonyms: EDDM2B EP2 EP2C EP2D HE2 HE2C SPAG11
Gene ID:
Human(10407) Summary: This gene encodes several androgen-dependent, epididymis-specific secretory proteins. The specific functions of these proteins have not been determined, but they are thought to be involved in sperm maturation. Some of the isoforms contain regions of similarity to beta-defensins, a family of antimicrobial peptides. The gene is located on chromosome 8p23 near the defensin gene cluster. Alternative splicing of this gene results in seven transcript variants encoding different isoforms. Two different N-terminal and five different C-terminal protein sequences are encoded by the splice variants. Two additional variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
Mouse(546038) sperm associated antigen 11B
Rat(246305) sperm associated antigen 11B
dog(100329110) sperm associated antigen 11B
cow(783025) sperm associated antigen 11B
naked mole-rat(101704602) sperm associated antigen 11B
domestic guinea pig(100713433) sperm associated antigen 11B
151 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV53717 Anti-SPAG11B antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4200676 Monoclonal Anti-SPAG11 antibody produced in mouse clone 10B4, purified from hybridoma cell culture mouse, rat
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_058207 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058207 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058207 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_058206 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058206 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058206 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001034905 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001034905 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001034905 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016512 Rosetta Predictions human pricing
NM_058200 Rosetta Predictions human pricing
NM_058201 Rosetta Predictions human pricing
NM_058202 Rosetta Predictions human pricing
NM_058203 Rosetta Predictions human pricing
NM_058206 Rosetta Predictions human pricing
NM_058207 Rosetta Predictions human pricing
NM_145087 Rosetta Predictions rat pricing
NM_001034905 Rosetta Predictions mouse pricing
NM_001039563 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202954 predicted 314
2 SASI_Hs01_00202955 predicted 323
3 SASI_Hs01_00202956 predicted 203
4 SASI_Hs01_00202957 predicted 399
5 SASI_Hs01_00202958 predicted 400
6 SASI_Hs01_00202959 predicted 397
7 SASI_Hs01_00202960 predicted 255
8 SASI_Hs01_00202961 predicted 361
9 SASI_Hs01_00202963 predicted 299
10 SASI_Hs02_00349603 predicted 267
11 SASI_Hs01_00202962 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188542 predicted 385
2 SASI_Hs01_00188543 predicted 323
3 SASI_Hs01_00188544 predicted 475
4 SASI_Hs01_00188545 predicted 375
5 SASI_Hs02_00362116 predicted 409
6 SASI_Hs01_00188546 predicted 484
7 SASI_Hs02_00362117 predicted 313
8 SASI_Hs01_00188541 predicted 425
9 SASI_Hs02_00362118 predicted 306
10 SASI_Hs02_00362119 predicted 519
11 SASI_Hs01_00188547 predicted 418
12 SASI_Hs01_00188548 predicted 251
13 SASI_Hs01_00188549 predicted 407
14 SASI_Hs01_00188550 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362120 predicted 332
2 SASI_Hs01_00022814 predicted 316
3 SASI_Hs01_00022815 predicted 329
4 SASI_Hs01_00022816 predicted 204
5 SASI_Hs01_00022817 predicted 254
6 SASI_Hs01_00022818 predicted 321
7 SASI_Hs01_00022820 predicted 300
8 SASI_Hs01_00022821 predicted 268
9 SASI_Hs01_00022822 predicted 257
10 SASI_Hs01_00022823 predicted 229
11 SASI_Hs01_00022819 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362121 predicted 329
2 SASI_Hs01_00092597 predicted 323
3 SASI_Hs01_00092598 predicted 389
4 SASI_Hs01_00092599 predicted 254
5 SASI_Hs01_00092600 predicted 402
6 SASI_Hs01_00092601 predicted 315
7 SASI_Hs01_00092602 predicted 311
8 SASI_Hs01_00092605 predicted 303
9 SASI_Hs01_00092606 predicted 443
10 SASI_Hs02_00362122 predicted 254
11 SASI_Hs01_00092603 predicted 242
12 SASI_Hs01_00092604 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362123 predicted 256
2 SASI_Hs02_00362124 predicted 253
3 SASI_Hs01_00100201 predicted 208
4 SASI_Hs01_00100202 predicted 251
5 SASI_Hs02_00362125 predicted 265
6 SASI_Hs01_00100206 predicted 304
7 SASI_Hs01_00100207 predicted 263
8 SASI_Hs01_00100208 predicted 255
9 SASI_Hs01_00100209 predicted 234
10 SASI_Hs01_00100210 predicted 216
11 SASI_Hs01_00100203 predicted 247
12 SASI_Hs01_00100204 predicted 267
13 SASI_Hs01_00100205 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362126 predicted 305
2 SASI_Hs01_00130423 predicted 130
3 SASI_Hs01_00130424 predicted 128
4 SASI_Hs01_00130425 predicted 118
5 SASI_Hs02_00362127 predicted 266
6 SASI_Hs02_00362128 predicted 117
7 SASI_Hs01_00130426 predicted 269
8 SASI_Hs01_00130427 predicted 119
9 SASI_Hs01_00130429 predicted 291
10 SASI_Hs02_00362129 predicted 303
11 SASI_Hs01_00130421 predicted 224
12 SASI_Hs01_00130422 predicted 223
13 SASI_Hs01_00130428 predicted 221
14 SASI_Hs01_00130430 predicted 209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362130 predicted 228
2 SASI_Hs01_00187113 predicted 209
3 SASI_Hs01_00187114 predicted 220
4 SASI_Hs02_00362131 predicted 194
5 SASI_Hs01_00187116 predicted 198
6 SASI_Hs02_00362132 predicted 217
7 SASI_Hs01_00187118 predicted 216
8 SASI_Hs02_00362133 predicted 228
9 SASI_Hs01_00187120 predicted 212
10 SASI_Hs02_00362134 predicted 211
11 SASI_Hs01_00187111 predicted 121
12 SASI_Hs01_00187112 predicted 156
13 SASI_Hs01_00187115 predicted 156
14 SASI_Hs01_00187117 predicted 136
15 SASI_Hs01_00187119 predicted 124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093559 predicted 108
2 SASI_Rn01_00093560 predicted 258
3 SASI_Rn01_00093561 predicted 104
4 SASI_Rn01_00093562 predicted 226
5 SASI_Rn01_00093563 predicted 231
6 SASI_Rn01_00093564 predicted 270
7 SASI_Rn01_00093565 predicted 264
8 SASI_Rn02_00268672 predicted 260
9 SASI_Rn01_00093567 predicted 228
10 SASI_Rn01_00093568 predicted 216
11 SASI_Rn01_00093566 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124079 predicted 721
2 SASI_Mm01_00124080 predicted 314
3 SASI_Mm01_00124081 predicted 462
4 SASI_Mm01_00124082 predicted 654
5 SASI_Mm01_00124083 predicted 469
6 SASI_Mm01_00124084 predicted 461
7 SASI_Mm01_00124085 predicted 721
8 SASI_Mm01_00124086 predicted 465
9 SASI_Mm01_00124087 predicted 357
10 SASI_Mm01_00124088 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039563 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090700 predicted 215
2 SASI_Mm01_00090701 predicted 288
3 SASI_Mm01_00090702 predicted 259
4 SASI_Mm01_00090704 predicted 328
5 SASI_Mm01_00090705 predicted 117
6 SASI_Mm01_00090706 predicted 63
7 SASI_Mm02_00290159 predicted 262
8 SASI_Mm01_00090708 predicted 142
9 SASI_Mm02_00290160 predicted 334
10 SASI_Mm02_00290161 predicted 222
11 SASI_Mm01_00090699 predicted 157
12 SASI_Mm01_00090703 predicted 229
13 SASI_Mm01_00090707 predicted 349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058207
SPAG11B MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 11B
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000156338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058207.1-210s1c1
Sequence:CCGGCTGATCCCTGGAATAGGTGTTCTCGAGAACACCTATTCCAGGGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058207.1-117s1c1
Sequence:CCGGCACCGGGAATTAGAAATACCACTCGAGTGGTATTTCTAATTCCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058207.1-202s1c1
Sequence:CCGGCATTTGCTCTGATCCCTGGAACTCGAGTTCCAGGGATCAGAGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058207.1-110s1c1
Sequence:CCGGGATGTTCCACCGGGAATTAGACTCGAGTCTAATTCCCGGTGGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058207
SPAG11B MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 11B
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000156338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058207.1-210s1c1
Sequence:CCGGCTGATCCCTGGAATAGGTGTTCTCGAGAACACCTATTCCAGGGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058207.1-117s1c1
Sequence:CCGGCACCGGGAATTAGAAATACCACTCGAGTGGTATTTCTAATTCCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058207.1-202s1c1
Sequence:CCGGCATTTGCTCTGATCCCTGGAACTCGAGTTCCAGGGATCAGAGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058207.1-110s1c1
Sequence:CCGGGATGTTCCACCGGGAATTAGACTCGAGTCTAATTCCCGGTGGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058207
SPAG11B MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 11B
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000156338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058207.1-210s1c1
Sequence:CCGGCTGATCCCTGGAATAGGTGTTCTCGAGAACACCTATTCCAGGGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058207.1-117s1c1
Sequence:CCGGCACCGGGAATTAGAAATACCACTCGAGTGGTATTTCTAATTCCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058207.1-202s1c1
Sequence:CCGGCATTTGCTCTGATCCCTGGAACTCGAGTTCCAGGGATCAGAGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058207.1-110s1c1
Sequence:CCGGGATGTTCCACCGGGAATTAGACTCGAGTCTAATTCCCGGTGGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058206
SPAG11B MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 11B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058206.1-139s1c1
Sequence:CCGGCTCATTTAGGATCTGTGTGGACTCGAGTCCACACAGATCCTAAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058206.1-94s1c1
Sequence:CCGGCCAAACAAACTCAGTGCACATCTCGAGATGTGCACTGAGTTTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058206.1-141s1c1
Sequence:CCGGCATTTAGGATCTGTGTGGACTCTCGAGAGTCCACACAGATCCTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158289    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058206.1-292s1c1
Sequence:CCGGCCTGGAATAGGTGTTGCGTATCTCGAGATACGCAACACCTATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058206.1-135s1c1
Sequence:CCGGGACCCTCATTTAGGATCTGTGCTCGAGCACAGATCCTAAATGAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058206
SPAG11B MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 11B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058206.1-139s1c1
Sequence:CCGGCTCATTTAGGATCTGTGTGGACTCGAGTCCACACAGATCCTAAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058206.1-94s1c1
Sequence:CCGGCCAAACAAACTCAGTGCACATCTCGAGATGTGCACTGAGTTTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058206.1-141s1c1
Sequence:CCGGCATTTAGGATCTGTGTGGACTCTCGAGAGTCCACACAGATCCTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158289    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058206.1-292s1c1
Sequence:CCGGCCTGGAATAGGTGTTGCGTATCTCGAGATACGCAACACCTATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058206.1-135s1c1
Sequence:CCGGGACCCTCATTTAGGATCTGTGCTCGAGCACAGATCCTAAATGAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058206
SPAG11B MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 11B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058206.1-139s1c1
Sequence:CCGGCTCATTTAGGATCTGTGTGGACTCGAGTCCACACAGATCCTAAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058206.1-94s1c1
Sequence:CCGGCCAAACAAACTCAGTGCACATCTCGAGATGTGCACTGAGTTTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058206.1-141s1c1
Sequence:CCGGCATTTAGGATCTGTGTGGACTCTCGAGAGTCCACACAGATCCTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158289    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058206.1-292s1c1
Sequence:CCGGCCTGGAATAGGTGTTGCGTATCTCGAGATACGCAACACCTATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058206.1-135s1c1
Sequence:CCGGGACCCTCATTTAGGATCTGTGCTCGAGCACAGATCCTAAATGAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034905
SPAG11B MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 11B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034905.2-108s21c1
Sequence:CCGGGTCCAATGCCTCGTCCATTAACTCGAGTTAATGGACGAGGCATTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034905.2-1112s21c1
Sequence:CCGGGTATGCTGTGTGGCAATATTACTCGAGTAATATTGCCACACAGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034905.2-136s21c1
Sequence:CCGGGTCACTGAACCTCCCAGTTTCCTCGAGGAAACTGGGAGGTTCAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034905.2-205s21c1
Sequence:CCGGCATCACAGAGTGAAACGATTACTCGAGTAATCGTTTCACTCTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034905.2-279s21c1
Sequence:CCGGGTTCATCCACTTGGGAAATACCTCGAGGTATTTCCCAAGTGGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034905
SPAG11B MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 11B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034905.2-108s21c1
Sequence:CCGGGTCCAATGCCTCGTCCATTAACTCGAGTTAATGGACGAGGCATTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034905.2-1112s21c1
Sequence:CCGGGTATGCTGTGTGGCAATATTACTCGAGTAATATTGCCACACAGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034905.2-136s21c1
Sequence:CCGGGTCACTGAACCTCCCAGTTTCCTCGAGGAAACTGGGAGGTTCAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034905.2-205s21c1
Sequence:CCGGCATCACAGAGTGAAACGATTACTCGAGTAATCGTTTCACTCTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034905.2-279s21c1
Sequence:CCGGGTTCATCCACTTGGGAAATACCTCGAGGTATTTCCCAAGTGGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034905
SPAG11B MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 11B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034905.2-108s21c1
Sequence:CCGGGTCCAATGCCTCGTCCATTAACTCGAGTTAATGGACGAGGCATTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034905.2-1112s21c1
Sequence:CCGGGTATGCTGTGTGGCAATATTACTCGAGTAATATTGCCACACAGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034905.2-136s21c1
Sequence:CCGGGTCACTGAACCTCCCAGTTTCCTCGAGGAAACTGGGAGGTTCAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034905.2-205s21c1
Sequence:CCGGCATCACAGAGTGAAACGATTACTCGAGTAATCGTTTCACTCTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034905.2-279s21c1
Sequence:CCGGGTTCATCCACTTGGGAAATACCTCGAGGTATTTCCCAAGTGGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks