EMAIL THIS PAGE TO A FRIEND

SPAG16

sperm associated antigen 16

Synonyms: PF20 WDR29
Gene ID:
Human(79582) Summary: Cilia and flagella are comprised of a microtubular backbone, the axoneme, which is organized by the basal body and surrounded by plasma membrane. SPAG16 encodes 2 major proteins that associate with the axoneme of sperm tail and the nucleus of postmeiotic germ cells, respectively (Zhang et al., 2007 [PubMed 17699735]
Mouse(66722) sperm associated antigen 16
Rat(501158) sperm associated antigen 16
chicken(424009) sperm associated antigen 16
domestic cat(101101403) sperm associated antigen 16
dog(478899) sperm associated antigen 16
domestic guinea pig(100725763) sperm associated antigen 16
naked mole-rat(101724438) sperm associated antigen 16
cow(522957) sperm associated antigen 16
sheep(101104375) sperm associated antigen 16
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA037542 Anti-SPAG16 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB1303435 ANTI-SPG16 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024532 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024532 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024532 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025728 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025728 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025728 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU084441 MISSION® esiRNA esiRNA targeting mouse Spag16 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025436 Rosetta Predictions human pricing
NM_024532 Rosetta Predictions human pricing
NM_001134728 Rosetta Predictions rat pricing
NM_025728 Rosetta Predictions mouse pricing
NM_029160 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235847 predicted 392
2 SASI_Hs01_00235848 predicted 340
3 SASI_Hs01_00235850 predicted 224
4 SASI_Hs01_00235851 predicted 208
5 SASI_Hs01_00235852 predicted 215
6 SASI_Hs01_00235853 predicted 270
7 SASI_Hs01_00235854 predicted 395
8 SASI_Hs01_00235855 predicted 325
9 SASI_Hs01_00235856 predicted 306
10 SASI_Hs02_00307461 predicted 396
11 SASI_Hs01_00235849 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024532 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124996 predicted 394
2 SASI_Hs01_00124997 predicted 342
3 SASI_Hs01_00124999 predicted 224
4 SASI_Hs01_00125000 predicted 209
5 SASI_Hs01_00125001 predicted 219
6 SASI_Hs01_00125002 predicted 271
7 SASI_Hs01_00125003 predicted 401
8 SASI_Hs01_00125004 predicted 323
9 SASI_Hs01_00125005 predicted 300
10 SASI_Hs02_00356825 predicted 396
11 SASI_Hs01_00124998 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134728 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258194 predicted 877
2 SASI_Rn02_00258195 predicted 534
3 SASI_Rn02_00258196 predicted 989
4 SASI_Rn02_00258197 predicted 755
5 SASI_Rn02_00258198 predicted 691
6 SASI_Rn02_00258199 predicted 673
7 SASI_Rn02_00258200 predicted 851
8 SASI_Rn02_00258201 predicted 591
9 SASI_Rn02_00258202 predicted 461
10 SASI_Rn02_00258203 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025728 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328910 predicted 810
2 SASI_Mm01_00197240 predicted 491
3 SASI_Mm01_00197241 predicted 610
4 SASI_Mm01_00197242 predicted 640
5 SASI_Mm01_00197243 predicted 349
6 SASI_Mm01_00197244 predicted 951
7 SASI_Mm01_00197245 predicted 822
8 SASI_Mm01_00197246 predicted 434
9 SASI_Mm01_00197247 predicted 728
10 SASI_Mm01_00197248 predicted 895
11 SASI_Mm01_00197249 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029160 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334969 predicted 1641
2 SASI_Mm01_00137699 predicted 1331
3 SASI_Mm01_00137700 predicted 1448
4 SASI_Mm01_00137701 predicted 1471
5 SASI_Mm01_00137702 predicted 1183
6 SASI_Mm01_00137703 predicted 1796
7 SASI_Mm01_00137704 predicted 1657
8 SASI_Mm01_00137705 predicted 1272
9 SASI_Mm01_00137706 predicted 1562
10 SASI_Mm01_00137707 predicted 1732
11 SASI_Mm01_00137708 predicted 1793
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024532
SPAG16 MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 16
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024532.2-744s1c1
Sequence:CCGGCCACACTTTACTGAAGGAGAACTCGAGTTCTCCTTCAGTAAAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024532.2-352s1c1
Sequence:CCGGGCAGTACCTGAAGTAATAGAACTCGAGTTCTATTACTTCAGGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024532.2-703s1c1
Sequence:CCGGGCATCTTATGAACCGACTATACTCGAGTATAGTCGGTTCATAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024532.2-583s1c1
Sequence:CCGGGCTAGAGAAGATTTGCTGAAACTCGAGTTTCAGCAAATCTTCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024532.2-1586s1c1
Sequence:CCGGCACTTTATGGTCACATGCATTCTCGAGAATGCATGTGACCATAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024532.2-1511s1c1
Sequence:CCGGCCAATACTCTTCTCACAAGCTCTCGAGAGCTTGTGAGAAGAGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024532.2-1964s1c1
Sequence:CCGGGCATTCCCTTTAAGGCTTGAACTCGAGTTCAAGCCTTAAAGGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024532.2-712s1c1
Sequence:CCGGGAACCGACTATAAGGGTGTTACTCGAGTAACACCCTTATAGTCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024532.2-1008s1c1
Sequence:CCGGGCAACCAAATCCAAACCTGAACTCGAGTTCAGGTTTGGATTTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024532.2-1259s1c1
Sequence:CCGGGCGACAAATTGGCTACTTCAACTCGAGTTGAAGTAGCCAATTTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024532
SPAG16 MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 16
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024532.2-744s1c1
Sequence:CCGGCCACACTTTACTGAAGGAGAACTCGAGTTCTCCTTCAGTAAAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024532.2-352s1c1
Sequence:CCGGGCAGTACCTGAAGTAATAGAACTCGAGTTCTATTACTTCAGGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024532.2-703s1c1
Sequence:CCGGGCATCTTATGAACCGACTATACTCGAGTATAGTCGGTTCATAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024532.2-583s1c1
Sequence:CCGGGCTAGAGAAGATTTGCTGAAACTCGAGTTTCAGCAAATCTTCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024532.2-1586s1c1
Sequence:CCGGCACTTTATGGTCACATGCATTCTCGAGAATGCATGTGACCATAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024532.2-1511s1c1
Sequence:CCGGCCAATACTCTTCTCACAAGCTCTCGAGAGCTTGTGAGAAGAGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024532.2-1964s1c1
Sequence:CCGGGCATTCCCTTTAAGGCTTGAACTCGAGTTCAAGCCTTAAAGGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024532.2-712s1c1
Sequence:CCGGGAACCGACTATAAGGGTGTTACTCGAGTAACACCCTTATAGTCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024532.2-1008s1c1
Sequence:CCGGGCAACCAAATCCAAACCTGAACTCGAGTTCAGGTTTGGATTTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024532.2-1259s1c1
Sequence:CCGGGCGACAAATTGGCTACTTCAACTCGAGTTGAAGTAGCCAATTTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024532
SPAG16 MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 16
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024532.2-744s1c1
Sequence:CCGGCCACACTTTACTGAAGGAGAACTCGAGTTCTCCTTCAGTAAAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024532.2-352s1c1
Sequence:CCGGGCAGTACCTGAAGTAATAGAACTCGAGTTCTATTACTTCAGGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024532.2-703s1c1
Sequence:CCGGGCATCTTATGAACCGACTATACTCGAGTATAGTCGGTTCATAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024532.2-583s1c1
Sequence:CCGGGCTAGAGAAGATTTGCTGAAACTCGAGTTTCAGCAAATCTTCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024532.2-1586s1c1
Sequence:CCGGCACTTTATGGTCACATGCATTCTCGAGAATGCATGTGACCATAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024532.2-1511s1c1
Sequence:CCGGCCAATACTCTTCTCACAAGCTCTCGAGAGCTTGTGAGAAGAGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024532.2-1964s1c1
Sequence:CCGGGCATTCCCTTTAAGGCTTGAACTCGAGTTCAAGCCTTAAAGGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024532.2-712s1c1
Sequence:CCGGGAACCGACTATAAGGGTGTTACTCGAGTAACACCCTTATAGTCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024532.2-1008s1c1
Sequence:CCGGGCAACCAAATCCAAACCTGAACTCGAGTTCAGGTTTGGATTTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024532.2-1259s1c1
Sequence:CCGGGCGACAAATTGGCTACTTCAACTCGAGTTGAAGTAGCCAATTTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025728
SPAG16 MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 16
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000115511    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025728.1-1129s1c1
Sequence:CCGGGCATTCCCTCTAAGGCTTAAACTCGAGTTTAAGCCTTAGAGGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025728.1-609s1c1
Sequence:CCGGCGGTGCAGATACACTTTGTATCTCGAGATACAAAGTGTATCTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025728.1-673s1c1
Sequence:CCGGCCAACATTCTTCTCACCGCTTCTCGAGAAGCGGTGAGAAGAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025728.1-565s1c1
Sequence:CCGGCCTCACTGGATATGACGAGTACTCGAGTACTCGTCATATCCAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025728
SPAG16 MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 16
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000115511    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025728.1-1129s1c1
Sequence:CCGGGCATTCCCTCTAAGGCTTAAACTCGAGTTTAAGCCTTAGAGGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025728.1-609s1c1
Sequence:CCGGCGGTGCAGATACACTTTGTATCTCGAGATACAAAGTGTATCTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025728.1-673s1c1
Sequence:CCGGCCAACATTCTTCTCACCGCTTCTCGAGAAGCGGTGAGAAGAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025728.1-565s1c1
Sequence:CCGGCCTCACTGGATATGACGAGTACTCGAGTACTCGTCATATCCAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025728
SPAG16 MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 16
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000115511    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025728.1-1129s1c1
Sequence:CCGGGCATTCCCTCTAAGGCTTAAACTCGAGTTTAAGCCTTAGAGGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025728.1-609s1c1
Sequence:CCGGCGGTGCAGATACACTTTGTATCTCGAGATACAAAGTGTATCTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025728.1-673s1c1
Sequence:CCGGCCAACATTCTTCTCACCGCTTCTCGAGAAGCGGTGAGAAGAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025728.1-565s1c1
Sequence:CCGGCCTCACTGGATATGACGAGTACTCGAGTACTCGTCATATCCAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks