EMAIL THIS PAGE TO A FRIEND

SPAG17

sperm associated antigen 17

Synonyms: PF6 RP4-776P7.2
UniProtKB ID: Q6Q759, Q8NAZ1, Q9NT21
Gene ID:
Mouse(74362) sperm associated antigen 17
cow(535545) sperm associated antigen 17
sheep(101109497) sperm associated antigen 17
naked mole-rat(101704121) sperm associated antigen 17
Domestic Rabbit(100353938) sperm associated antigen 17
domestic guinea pig(100713796) sperm associated antigen 17
chicken(418315) sperm associated antigen 17
Horse(100059849) sperm associated antigen 17
domestic cat(101090538) sperm associated antigen 17
dog(607737) sperm associated antigen 17
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_206996 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206996 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206996 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028892 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028892 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028892 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU017001 MISSION® esiRNA esiRNA targeting human SPAG17 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_206996 Rosetta Predictions human pricing
NM_028892 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160595 predicted 1152
2 SASI_Hs02_00373685 predicted 264
3 SASI_Hs01_00160596 predicted 1059
4 SASI_Hs01_00160597 predicted 4069
5 SASI_Hs01_00160598 predicted 6600
6 SASI_Hs02_00373686 predicted 6308
7 SASI_Hs01_00160600 predicted 772
8 SASI_Hs01_00160601 predicted 5805
9 SASI_Hs02_00373687 predicted 5341
10 SASI_Hs02_00373688 predicted 6297
11 SASI_Hs01_00160599 predicted 5406
12 SASI_Hs01_00160602 predicted 2388
13 SASI_Hs01_00160603 predicted 4344
14 SASI_Hs01_00160604 predicted 4258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028892 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188959 predicted 6407
2 SASI_Mm02_00334576 predicted 2549
3 SASI_Mm01_00188961 predicted 798
4 SASI_Mm01_00188962 predicted 6904
5 SASI_Mm01_00188963 predicted 933
6 SASI_Mm01_00188964 predicted 5105
7 SASI_Mm01_00188965 predicted 3930
8 SASI_Mm01_00188966 predicted 5598
9 SASI_Mm01_00188967 predicted 6281
10 SASI_Mm02_00334577 predicted 5025
11 SASI_Mm01_00188960 predicted 5818
12 SASI_Mm01_00188968 predicted 4069
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206996
SPAG17 MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 17
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206996.1-709s1c1
Sequence:CCGGGCCCAACATTACATTATAGTTCTCGAGAACTATAATGTAATGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206996.1-3452s1c1
Sequence:CCGGCGATAAGTTACTATGGATCAACTCGAGTTGATCCATAGTAACTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206996.1-1267s1c1
Sequence:CCGGGCACAGTATGAAGAACCGCAACTCGAGTTGCGGTTCTTCATACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206996.2-4856s21c1
Sequence:CCGGTGGTAGCATATCAACTATATTCTCGAGAATATAGTTGATATGCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206996.2-2044s21c1
Sequence:CCGGCCAAGCAGAAAGCAGATATTACTCGAGTAATATCTGCTTTCTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206996.2-795s21c1
Sequence:CCGGCCTATAACCAGCGTGATTAAACTCGAGTTTAATCACGCTGGTTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206996.2-5771s21c1
Sequence:CCGGGGATATTAAGAACCGCATAATCTCGAGATTATGCGGTTCTTAATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206996.2-6894s21c1
Sequence:CCGGTTTAATAAAGACGTGCGAATACTCGAGTATTCGCACGTCTTTATTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206996
SPAG17 MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 17
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206996.1-709s1c1
Sequence:CCGGGCCCAACATTACATTATAGTTCTCGAGAACTATAATGTAATGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206996.1-3452s1c1
Sequence:CCGGCGATAAGTTACTATGGATCAACTCGAGTTGATCCATAGTAACTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206996.1-1267s1c1
Sequence:CCGGGCACAGTATGAAGAACCGCAACTCGAGTTGCGGTTCTTCATACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206996.2-4856s21c1
Sequence:CCGGTGGTAGCATATCAACTATATTCTCGAGAATATAGTTGATATGCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206996.2-2044s21c1
Sequence:CCGGCCAAGCAGAAAGCAGATATTACTCGAGTAATATCTGCTTTCTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206996.2-795s21c1
Sequence:CCGGCCTATAACCAGCGTGATTAAACTCGAGTTTAATCACGCTGGTTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206996.2-5771s21c1
Sequence:CCGGGGATATTAAGAACCGCATAATCTCGAGATTATGCGGTTCTTAATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206996.2-6894s21c1
Sequence:CCGGTTTAATAAAGACGTGCGAATACTCGAGTATTCGCACGTCTTTATTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206996
SPAG17 MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 17
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206996.1-709s1c1
Sequence:CCGGGCCCAACATTACATTATAGTTCTCGAGAACTATAATGTAATGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206996.1-3452s1c1
Sequence:CCGGCGATAAGTTACTATGGATCAACTCGAGTTGATCCATAGTAACTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206996.1-1267s1c1
Sequence:CCGGGCACAGTATGAAGAACCGCAACTCGAGTTGCGGTTCTTCATACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206996.2-4856s21c1
Sequence:CCGGTGGTAGCATATCAACTATATTCTCGAGAATATAGTTGATATGCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206996.2-2044s21c1
Sequence:CCGGCCAAGCAGAAAGCAGATATTACTCGAGTAATATCTGCTTTCTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206996.2-795s21c1
Sequence:CCGGCCTATAACCAGCGTGATTAAACTCGAGTTTAATCACGCTGGTTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206996.2-5771s21c1
Sequence:CCGGGGATATTAAGAACCGCATAATCTCGAGATTATGCGGTTCTTAATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206996.2-6894s21c1
Sequence:CCGGTTTAATAAAGACGTGCGAATACTCGAGTATTCGCACGTCTTTATTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028892
SPAG17 MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 17
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028892.1-2086s1c1
Sequence:CCGGGAGAACACTATTTGTGAACAACTCGAGTTGTTCACAAATAGTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028892.1-1801s1c1
Sequence:CCGGCGCCACTATTCACGAGCTTATCTCGAGATAAGCTCGTGAATAGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028892.4-5482s21c1
Sequence:CCGGATTTCCCTTAAGGACTATATACTCGAGTATATAGTCCTTAAGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028892.4-363s21c1
Sequence:CCGGTGTCAATTTACCGTTACATTACTCGAGTAATGTAACGGTAAATTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028892.4-6723s21c1
Sequence:CCGGTGGACTGAAAGTGACATATAACTCGAGTTATATGTCACTTTCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028892.4-6837s1c1
Sequence:CCGGCATCTCCCACAATATCGAAATCTCGAGATTTCGATATTGTGGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028892.4-7158s21c1
Sequence:CCGGGTAGCCTGAATCGGCTTAATACTCGAGTATTAAGCCGATTCAGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028892.4-5872s21c1
Sequence:CCGGTCCGAATTGAGCTCGTTATTTCTCGAGAAATAACGAGCTCAATTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028892
SPAG17 MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 17
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028892.1-2086s1c1
Sequence:CCGGGAGAACACTATTTGTGAACAACTCGAGTTGTTCACAAATAGTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028892.1-1801s1c1
Sequence:CCGGCGCCACTATTCACGAGCTTATCTCGAGATAAGCTCGTGAATAGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028892.4-5482s21c1
Sequence:CCGGATTTCCCTTAAGGACTATATACTCGAGTATATAGTCCTTAAGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028892.4-363s21c1
Sequence:CCGGTGTCAATTTACCGTTACATTACTCGAGTAATGTAACGGTAAATTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028892.4-6723s21c1
Sequence:CCGGTGGACTGAAAGTGACATATAACTCGAGTTATATGTCACTTTCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028892.4-6837s1c1
Sequence:CCGGCATCTCCCACAATATCGAAATCTCGAGATTTCGATATTGTGGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028892.4-7158s21c1
Sequence:CCGGGTAGCCTGAATCGGCTTAATACTCGAGTATTAAGCCGATTCAGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028892.4-5872s21c1
Sequence:CCGGTCCGAATTGAGCTCGTTATTTCTCGAGAAATAACGAGCTCAATTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028892
SPAG17 MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 17
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028892.1-2086s1c1
Sequence:CCGGGAGAACACTATTTGTGAACAACTCGAGTTGTTCACAAATAGTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028892.1-1801s1c1
Sequence:CCGGCGCCACTATTCACGAGCTTATCTCGAGATAAGCTCGTGAATAGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028892.4-5482s21c1
Sequence:CCGGATTTCCCTTAAGGACTATATACTCGAGTATATAGTCCTTAAGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028892.4-363s21c1
Sequence:CCGGTGTCAATTTACCGTTACATTACTCGAGTAATGTAACGGTAAATTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028892.4-6723s21c1
Sequence:CCGGTGGACTGAAAGTGACATATAACTCGAGTTATATGTCACTTTCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028892.4-6837s1c1
Sequence:CCGGCATCTCCCACAATATCGAAATCTCGAGATTTCGATATTGTGGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028892.4-7158s21c1
Sequence:CCGGGTAGCCTGAATCGGCTTAATACTCGAGTATTAAGCCGATTCAGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028892.4-5872s21c1
Sequence:CCGGTCCGAATTGAGCTCGTTATTTCTCGAGAAATAACGAGCTCAATTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks