EMAIL THIS PAGE TO A FRIEND

SPAG1

sperm associated antigen 1

Synonyms: HSD-3.8 SP75 TPIS
UniProtKB ID: Q07617, A6NP70, Q7Z5G1
Gene ID:
Human(6674) Summary: The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm agglutinating antibodies from an infertile woman. Furthermore, immunization of female rats with the recombinant human protein reduced fertility. This protein localizes to the plasma membrane of germ cells in the testis and to the post-acrosomal plasma membrane of mature spermatozoa. Recombinant polypeptide binds GTP and exhibits GTPase activity. Thus, this protein may regulate GTP signal transduction pathways involved in spermatogenesis and fertilization. Two transcript variants of this gene encode the same protein. [provided by RefSeq, Jul 2008]
Mouse(26942) sperm associated antigen 1
Rat(315033) sperm associated antigen 1
chicken(420249) sperm associated antigen 1
dog(607063) sperm associated antigen 1
domestic cat(101082465) sperm associated antigen 1
cow(530104) sperm associated antigen 1
sheep(101104833) sperm associated antigen 1
domestic guinea pig(100728301) sperm associated antigen 1
naked mole-rat(101713115) sperm associated antigen 1
108 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172218 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172218 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172218 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012031 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012031 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012031 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003114 Rosetta Predictions human pricing
NM_172218 Rosetta Predictions human pricing
NM_001012116 Rosetta Predictions rat pricing
XM_576250 Rosetta Predictions rat pricing
NM_012031 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182163 predicted 2337
2 SASI_Hs01_00182165 predicted 2818
3 SASI_Hs01_00182166 predicted 920
4 SASI_Hs01_00182167 predicted 2171
5 SASI_Hs01_00182168 predicted 740
6 SASI_Hs01_00182169 predicted 1723
7 SASI_Hs02_00335082 predicted 728
8 SASI_Hs02_00335083 predicted 2783
9 SASI_Hs01_00182171 predicted 479
10 SASI_Hs02_00335084 predicted 2072
11 SASI_Hs01_00182162 predicted 2955
12 SASI_Hs01_00182164 predicted 2464
13 SASI_Hs01_00182170 predicted 2160
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049236 predicted 2233
2 SASI_Hs01_00049238 predicted 2708
3 SASI_Hs01_00049239 predicted 823
4 SASI_Hs01_00049240 predicted 2058
5 SASI_Hs01_00049241 predicted 631
6 SASI_Hs01_00049242 predicted 1625
7 SASI_Hs02_00367930 predicted 622
8 SASI_Hs02_00367931 predicted 2674
9 SASI_Hs01_00049244 predicted 375
10 SASI_Hs02_00367932 predicted 1965
11 SASI_Hs01_00049235 predicted 2850
12 SASI_Hs01_00049237 predicted 2353
13 SASI_Hs01_00049243 predicted 2056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012116 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200276 predicted 807
2 SASI_Rn01_00089753 predicted 762
3 SASI_Rn01_00089754 predicted 1000
4 SASI_Rn02_00200277 predicted 2622
5 SASI_Rn01_00089755 predicted 3046
6 SASI_Rn01_00089756 predicted 2211
7 SASI_Rn01_00089757 predicted 291
8 SASI_Rn01_00089758 predicted 2155
9 SASI_Rn01_00089760 predicted 2352
10 SASI_Rn01_00089761 predicted 1917
11 SASI_Rn01_00089752 predicted 2891
12 SASI_Rn01_00089759 predicted 2582
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576250 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00169080 predicted 2882
2 SASI_Rn01_00169081 predicted 2630
3 SASI_Rn01_00169082 predicted 3053
4 SASI_Rn01_00169083 predicted 2218
5 SASI_Rn01_00169084 predicted 2158
6 SASI_Rn01_00169085 predicted 2576
7 SASI_Rn01_00169086 predicted 2365
8 SASI_Rn01_00169087 predicted 1923
9 SASI_Rn01_00169088 predicted 1929
10 SASI_Rn01_00169089 predicted 2939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012031 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084375 predicted 753
2 SASI_Mm01_00084376 predicted 1177
3 SASI_Mm01_00084378 predicted 709
4 SASI_Mm01_00084379 predicted 983
5 SASI_Mm01_00084380 predicted 1585
6 SASI_Mm02_00321998 predicted 2105
7 SASI_Mm01_00084381 predicted 1182
8 SASI_Mm02_00321999 predicted 2896
9 SASI_Mm01_00084382 predicted 2330
10 SASI_Mm01_00084383 predicted 1721
11 SASI_Mm01_00084377 predicted 783
12 SASI_Mm01_00084384 predicted 2919
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172218
VALIDATED
SPAG1 MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_172218.1-2466s1c1
Sequence:CCGGGACCCTGAGAAACTTCCGATACTCGAGTATCGGAAGTTTCTCAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_172218.1-3317s1c1
Sequence:CCGGCCTGTGGATTACAGTCAGTTACTCGAGTAACTGACTGTAATCCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172218.1-3179s1c1
Sequence:CCGGGCTATGAAGGAGTCCTCTTAACTCGAGTTAAGAGGACTCCTTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172218.1-816s1c1
Sequence:CCGGGCCTATAACAATCGAGCTCAACTCGAGTTGAGCTCGATTGTTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172218.1-926s1c1
Sequence:CCGGGCGTCGTGCTACTACATATAACTCGAGTTATATGTAGTAGCACGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172218.1-1534s21c1
Sequence:CCGGCAGATGATCTAAGTATCTTATCTCGAGATAAGATACTTAGATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172218.1-1740s21c1
Sequence:CCGGTGTGGACTCCAGCTAGCAAATCTCGAGATTTGCTAGCTGGAGTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172218
VALIDATED
SPAG1 MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_172218.1-2466s1c1
Sequence:CCGGGACCCTGAGAAACTTCCGATACTCGAGTATCGGAAGTTTCTCAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_172218.1-3317s1c1
Sequence:CCGGCCTGTGGATTACAGTCAGTTACTCGAGTAACTGACTGTAATCCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172218.1-3179s1c1
Sequence:CCGGGCTATGAAGGAGTCCTCTTAACTCGAGTTAAGAGGACTCCTTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172218.1-816s1c1
Sequence:CCGGGCCTATAACAATCGAGCTCAACTCGAGTTGAGCTCGATTGTTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172218.1-926s1c1
Sequence:CCGGGCGTCGTGCTACTACATATAACTCGAGTTATATGTAGTAGCACGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172218.1-1534s21c1
Sequence:CCGGCAGATGATCTAAGTATCTTATCTCGAGATAAGATACTTAGATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172218.1-1740s21c1
Sequence:CCGGTGTGGACTCCAGCTAGCAAATCTCGAGATTTGCTAGCTGGAGTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172218
VALIDATED
SPAG1 MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_172218.1-2466s1c1
Sequence:CCGGGACCCTGAGAAACTTCCGATACTCGAGTATCGGAAGTTTCTCAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_172218.1-3317s1c1
Sequence:CCGGCCTGTGGATTACAGTCAGTTACTCGAGTAACTGACTGTAATCCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172218.1-3179s1c1
Sequence:CCGGGCTATGAAGGAGTCCTCTTAACTCGAGTTAAGAGGACTCCTTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172218.1-816s1c1
Sequence:CCGGGCCTATAACAATCGAGCTCAACTCGAGTTGAGCTCGATTGTTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172218.1-926s1c1
Sequence:CCGGGCGTCGTGCTACTACATATAACTCGAGTTATATGTAGTAGCACGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172218.1-1534s21c1
Sequence:CCGGCAGATGATCTAAGTATCTTATCTCGAGATAAGATACTTAGATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172218.1-1740s21c1
Sequence:CCGGTGTGGACTCCAGCTAGCAAATCTCGAGATTTGCTAGCTGGAGTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012031
VALIDATED
SPAG1 MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012031.1-3297s1c1
Sequence:CCGGCCACTTTCTGTCCCACTCAAACTCGAGTTTGAGTGGGACAGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_012031.1-1085s1c1
Sequence:CCGGGCCACTACATATAAACATCAACTCGAGTTGATGTTTATATGTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012031.1-1874s1c1
Sequence:CCGGGCACGAATCTTAACAGAGCTACTCGAGTAGCTCTGTTAAGATTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_012031.1-2659s1c1
Sequence:CCGGCCTGCCACTGTTGCTAAGTAACTCGAGTTACTTAGCAACAGTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012031.1-2557s1c1
Sequence:CCGGGCCTACTAATGCCTATGAGTTCTCGAGAACTCATAGGCATTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012031.3-2554s21c1
Sequence:CCGGGACGTCTCCAAGCCTACTAATCTCGAGATTAGTAGGCTTGGAGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_012031.3-1056s21c1
Sequence:CCGGGCTAGATCCCGGAAACGTAAACTCGAGTTTACGTTTCCGGGATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012031.3-2976s21c1
Sequence:CCGGGATGCAGTTGCATGGGTAAAGCTCGAGCTTTACCCATGCAACTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012031.3-2808s21c1
Sequence:CCGGGACGATGCTGACACTAATTAACTCGAGTTAATTAGTGTCAGCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_012031.3-984s21c1
Sequence:CCGGCAATCGAGCTCAGGCCGAAATCTCGAGATTTCGGCCTGAGCTCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012031
VALIDATED
SPAG1 MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012031.1-3297s1c1
Sequence:CCGGCCACTTTCTGTCCCACTCAAACTCGAGTTTGAGTGGGACAGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_012031.1-1085s1c1
Sequence:CCGGGCCACTACATATAAACATCAACTCGAGTTGATGTTTATATGTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012031.1-1874s1c1
Sequence:CCGGGCACGAATCTTAACAGAGCTACTCGAGTAGCTCTGTTAAGATTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_012031.1-2659s1c1
Sequence:CCGGCCTGCCACTGTTGCTAAGTAACTCGAGTTACTTAGCAACAGTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012031.1-2557s1c1
Sequence:CCGGGCCTACTAATGCCTATGAGTTCTCGAGAACTCATAGGCATTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012031.3-2554s21c1
Sequence:CCGGGACGTCTCCAAGCCTACTAATCTCGAGATTAGTAGGCTTGGAGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_012031.3-1056s21c1
Sequence:CCGGGCTAGATCCCGGAAACGTAAACTCGAGTTTACGTTTCCGGGATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012031.3-2976s21c1
Sequence:CCGGGATGCAGTTGCATGGGTAAAGCTCGAGCTTTACCCATGCAACTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012031.3-2808s21c1
Sequence:CCGGGACGATGCTGACACTAATTAACTCGAGTTAATTAGTGTCAGCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_012031.3-984s21c1
Sequence:CCGGCAATCGAGCTCAGGCCGAAATCTCGAGATTTCGGCCTGAGCTCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012031
VALIDATED
SPAG1 MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012031.1-3297s1c1
Sequence:CCGGCCACTTTCTGTCCCACTCAAACTCGAGTTTGAGTGGGACAGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_012031.1-1085s1c1
Sequence:CCGGGCCACTACATATAAACATCAACTCGAGTTGATGTTTATATGTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012031.1-1874s1c1
Sequence:CCGGGCACGAATCTTAACAGAGCTACTCGAGTAGCTCTGTTAAGATTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_012031.1-2659s1c1
Sequence:CCGGCCTGCCACTGTTGCTAAGTAACTCGAGTTACTTAGCAACAGTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012031.1-2557s1c1
Sequence:CCGGGCCTACTAATGCCTATGAGTTCTCGAGAACTCATAGGCATTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012031.3-2554s21c1
Sequence:CCGGGACGTCTCCAAGCCTACTAATCTCGAGATTAGTAGGCTTGGAGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_012031.3-1056s21c1
Sequence:CCGGGCTAGATCCCGGAAACGTAAACTCGAGTTTACGTTTCCGGGATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012031.3-2976s21c1
Sequence:CCGGGATGCAGTTGCATGGGTAAAGCTCGAGCTTTACCCATGCAACTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012031.3-2808s21c1
Sequence:CCGGGACGATGCTGACACTAATTAACTCGAGTTAATTAGTGTCAGCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_012031.3-984s21c1
Sequence:CCGGCAATCGAGCTCAGGCCGAAATCTCGAGATTTCGGCCTGAGCTCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks