EMAIL THIS PAGE TO A FRIEND

SPAG4

sperm associated antigen 4

Synonyms: CT127 SUN4
UniProtKB ID: Q9NPE6, O43648
Gene ID:
Human(6676) Summary: The mammalian sperm flagellum contains two cytoskeletal structures associated with the axoneme: the outer dense fibers surrounding the axoneme in the midpiece and principal piece and the fibrous sheath surrounding the outer dense fibers in the principal piece of the tail. Defects in these structures are associated with abnormal tail morphology, reduced sperm motility, and infertility. In the rat, the protein encoded by this gene associates with an outer dense fiber protein via a leucine zipper motif and localizes to the microtubules of the manchette and axoneme during sperm tail development. [provided by RefSeq, Jul 2008]
Mouse(245865) sperm associated antigen 4
Rat(83623) sperm associated antigen 4
fruit fly(34581) sperm-associated antigen 4
chicken(426655) sperm associated antigen 4
domestic cat(101080446) sperm associated antigen 4
dog(485854) sperm associated antigen 4
domestic guinea pig(100731278) sperm associated antigen 4
Domestic Rabbit(100328707) sperm associated antigen 4
naked mole-rat(101701483) sperm associated antigen 4
cow(618468) sperm associated antigen 4
sheep(101120855) sperm associated antigen 4
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003116 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003116 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003116 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139151 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139151 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139151 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056681 MISSION® esiRNA esiRNA human SPAG4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003116 Rosetta Predictions human pricing
NM_031792 Rosetta Predictions rat pricing
NM_139151 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335087 predicted 639
2 SASI_Hs02_00335088 predicted 948
3 SASI_Hs01_00194723 predicted 565
4 SASI_Hs01_00194724 predicted 1092
5 SASI_Hs01_00194727 predicted 499
6 SASI_Hs01_00194728 predicted 619
7 SASI_Hs01_00194729 predicted 918
8 SASI_Hs01_00194730 predicted 1223
9 SASI_Hs01_00194731 predicted 444
10 SASI_Hs01_00194732 predicted 955
11 SASI_Hs01_00194725 predicted 892
12 SASI_Hs01_00194726 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031792 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047210 predicted 963
2 SASI_Rn01_00047211 predicted 1013
3 SASI_Rn01_00047212 predicted 1084
4 SASI_Rn01_00047213 predicted 1016
5 SASI_Rn01_00047214 predicted 688
6 SASI_Rn01_00047215 predicted 1206
7 SASI_Rn01_00047216 predicted 926
8 SASI_Rn01_00047217 predicted 951
9 SASI_Rn01_00047219 predicted 951
10 SASI_Rn02_00265231 predicted 325
11 SASI_Rn01_00047218 predicted 1237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339909 predicted 1062
2 SASI_Mm02_00339910 predicted 1133
3 SASI_Mm02_00339911 predicted 669
4 SASI_Mm01_00067244 predicted 888
5 SASI_Mm01_00067245 predicted 656
6 SASI_Mm02_00339912 predicted 1239
7 SASI_Mm02_00339913 predicted 200
8 SASI_Mm02_00339914 predicted 1074
9 SASI_Mm01_00067248 predicted 365
10 SASI_Mm02_00339915 predicted 994
11 SASI_Mm01_00067246 predicted 716
12 SASI_Mm01_00067247 predicted 715
13 SASI_Mm01_00067249 predicted 880
14 SASI_Mm01_00067250 predicted 512
15 SASI_Mm01_00067251 predicted 745
16 SASI_Mm01_00067252 predicted 687
17 SASI_Mm01_00067253 predicted 348
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003116
SPAG4 MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-927s1c1
Sequence:CCGGGCAGAAGACATCCCACGATTACTCGAGTAATCGTGGGATGTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-183s1c1
Sequence:CCGGCGAGAACAGCTCAATGAGCATCTCGAGATGCTCATTGAGCTGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-975s1c1
Sequence:CCGGGAATCGCTTCAGCTTCTGGAACTCGAGTTCCAGAAGCTGAAGCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-1245s1c1
Sequence:CCGGCGATGTTGAGAAATCGGAGATCTCGAGATCTCCGATTTCTCAACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-1200s1c1
Sequence:CCGGCCAGGTTTATGATGAAACTGACTCGAGTCAGTTTCATCATAAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-1254s1c1
Sequence:CCGGGAAATCGGAGATTCAGACTTTCTCGAGAAAGTCTGAATCTCCGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-1246s1c1
Sequence:CCGGGATGTTGAGAAATCGGAGATTCTCGAGAATCTCCGATTTCTCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-704s1c1
Sequence:CCGGCTAAGGAGATGCTGACTCTAACTCGAGTTAGAGTCAGCATCTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-855s1c1
Sequence:CCGGCCAGAGGCTGAATGAGGATTTCTCGAGAAATCCTCATTCAGCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-639s1c1
Sequence:CCGGGAGCCTCTTTCTGTCAGCATTCTCGAGAATGCTGACAGAAAGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003116
SPAG4 MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-927s1c1
Sequence:CCGGGCAGAAGACATCCCACGATTACTCGAGTAATCGTGGGATGTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-183s1c1
Sequence:CCGGCGAGAACAGCTCAATGAGCATCTCGAGATGCTCATTGAGCTGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-975s1c1
Sequence:CCGGGAATCGCTTCAGCTTCTGGAACTCGAGTTCCAGAAGCTGAAGCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-1245s1c1
Sequence:CCGGCGATGTTGAGAAATCGGAGATCTCGAGATCTCCGATTTCTCAACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-1200s1c1
Sequence:CCGGCCAGGTTTATGATGAAACTGACTCGAGTCAGTTTCATCATAAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-1254s1c1
Sequence:CCGGGAAATCGGAGATTCAGACTTTCTCGAGAAAGTCTGAATCTCCGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-1246s1c1
Sequence:CCGGGATGTTGAGAAATCGGAGATTCTCGAGAATCTCCGATTTCTCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-704s1c1
Sequence:CCGGCTAAGGAGATGCTGACTCTAACTCGAGTTAGAGTCAGCATCTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-855s1c1
Sequence:CCGGCCAGAGGCTGAATGAGGATTTCTCGAGAAATCCTCATTCAGCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-639s1c1
Sequence:CCGGGAGCCTCTTTCTGTCAGCATTCTCGAGAATGCTGACAGAAAGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003116
SPAG4 MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-927s1c1
Sequence:CCGGGCAGAAGACATCCCACGATTACTCGAGTAATCGTGGGATGTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-183s1c1
Sequence:CCGGCGAGAACAGCTCAATGAGCATCTCGAGATGCTCATTGAGCTGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-975s1c1
Sequence:CCGGGAATCGCTTCAGCTTCTGGAACTCGAGTTCCAGAAGCTGAAGCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-1245s1c1
Sequence:CCGGCGATGTTGAGAAATCGGAGATCTCGAGATCTCCGATTTCTCAACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-1200s1c1
Sequence:CCGGCCAGGTTTATGATGAAACTGACTCGAGTCAGTTTCATCATAAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-1254s1c1
Sequence:CCGGGAAATCGGAGATTCAGACTTTCTCGAGAAAGTCTGAATCTCCGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-1246s1c1
Sequence:CCGGGATGTTGAGAAATCGGAGATTCTCGAGAATCTCCGATTTCTCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-704s1c1
Sequence:CCGGCTAAGGAGATGCTGACTCTAACTCGAGTTAGAGTCAGCATCTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-855s1c1
Sequence:CCGGCCAGAGGCTGAATGAGGATTTCTCGAGAAATCCTCATTCAGCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003116.1-639s1c1
Sequence:CCGGGAGCCTCTTTCTGTCAGCATTCTCGAGAATGCTGACAGAAAGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139151
VALIDATED
SPAG4 MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139151.2-1855s1c1
Sequence:CCGGCCCTGCTAACATCTTTCTAATCTCGAGATTAGAAAGATGTTAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139151.2-172s1c1
Sequence:CCGGCTCTCATAATCACACACCCAACTCGAGTTGGGTGTGTGATTATGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139151.2-187s1c1
Sequence:CCGGACCCAACTTCTACAGCGAGAACTCGAGTTCTCGCTGTAGAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139151.2-198s1c1
Sequence:CCGGACAGCGAGAACAGCAATAGTTCTCGAGAACTATTGCTGTTCTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139151.2-419s1c1
Sequence:CCGGGCGGCAACCAACCGTCTGGATCTCGAGATCCAGACGGTTGGTTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139151
VALIDATED
SPAG4 MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139151.2-1855s1c1
Sequence:CCGGCCCTGCTAACATCTTTCTAATCTCGAGATTAGAAAGATGTTAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139151.2-172s1c1
Sequence:CCGGCTCTCATAATCACACACCCAACTCGAGTTGGGTGTGTGATTATGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139151.2-187s1c1
Sequence:CCGGACCCAACTTCTACAGCGAGAACTCGAGTTCTCGCTGTAGAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139151.2-198s1c1
Sequence:CCGGACAGCGAGAACAGCAATAGTTCTCGAGAACTATTGCTGTTCTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139151.2-419s1c1
Sequence:CCGGGCGGCAACCAACCGTCTGGATCTCGAGATCCAGACGGTTGGTTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139151
VALIDATED
SPAG4 MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139151.2-1855s1c1
Sequence:CCGGCCCTGCTAACATCTTTCTAATCTCGAGATTAGAAAGATGTTAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139151.2-172s1c1
Sequence:CCGGCTCTCATAATCACACACCCAACTCGAGTTGGGTGTGTGATTATGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139151.2-187s1c1
Sequence:CCGGACCCAACTTCTACAGCGAGAACTCGAGTTCTCGCTGTAGAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139151.2-198s1c1
Sequence:CCGGACAGCGAGAACAGCAATAGTTCTCGAGAACTATTGCTGTTCTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139151.2-419s1c1
Sequence:CCGGGCGGCAACCAACCGTCTGGATCTCGAGATCCAGACGGTTGGTTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks