EMAIL THIS PAGE TO A FRIEND

SPAG5

sperm associated antigen 5

Synonyms: DEEPEST MAP126 hMAP126
UniProtKB ID: Q96R06, O95213, Q9BWE8, Q9NT17, Q9UFE6
Gene ID:
Human(10615) Summary: This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles. [provided by RefSeq, Jul 2008]
Mouse(54141) sperm associated antigen 5
Rat(252918) sperm associated antigen 5
cow(504585) sperm associated antigen 5
sheep(101105670) sperm associated antigen 5
naked mole-rat(101710859) sperm associated antigen 5
domestic guinea pig(100725571) sperm associated antigen 5
chicken(771702) sperm associated antigen 5
Horse(100059272) sperm associated antigen 5
domestic cat(101098415) sperm associated antigen 5
dog(480623) sperm associated antigen 5
Gene Class: Cytoskeleton
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017407 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017407 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017407 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006461 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006461 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006461 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006461 Rosetta Predictions human pricing
NM_001044224 Rosetta Predictions rat pricing
NM_017407 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208434 predicted 349
2 SASI_Hs01_00208435 predicted 2029
3 SASI_Hs01_00208436 predicted 2346
4 SASI_Hs01_00208437 predicted 3049
5 SASI_Hs01_00208438 predicted 558
6 SASI_Hs01_00208439 predicted 437
7 SASI_Hs01_00208441 predicted 973
8 SASI_Hs01_00208442 predicted 1637
9 SASI_Hs01_00208443 predicted 1133
10 SASI_Hs02_00341613 predicted 2621
11 SASI_Hs01_00208440 predicted 2087
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044224 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204967 predicted 2132
2 SASI_Rn02_00204968 predicted 308
3 SASI_Rn02_00204969 predicted 2118
4 SASI_Rn02_00204970 predicted 3519
5 SASI_Rn02_00204971 predicted 3502
6 SASI_Rn02_00204972 predicted 930
7 SASI_Rn02_00204973 predicted 3350
8 SASI_Rn02_00204974 predicted 3541
9 SASI_Rn02_00204975 predicted 2152
10 SASI_Rn02_00204976 predicted 3179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161720 predicted 2033
2 SASI_Mm01_00161721 predicted 3497
3 SASI_Mm01_00161722 predicted 2950
4 SASI_Mm01_00161723 predicted 2398
5 SASI_Mm01_00161724 predicted 2023
6 SASI_Mm01_00161725 predicted 2284
7 SASI_Mm01_00161727 predicted 3262
8 SASI_Mm01_00161728 predicted 1885
9 SASI_Mm01_00161729 predicted 1012
10 SASI_Mm02_00323923 predicted 1759
11 SASI_Mm01_00161726 predicted 2069
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017407
VALIDATED
SPAG5 MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120642    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017407.1-3613s1c1
Sequence:CCGGCCCAGGAATTTGGGAACCTAACTCGAGTTAGGTTCCCAAATTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017407.1-581s1c1
Sequence:CCGGGCCTAACAGAAATTGTTGCTACTCGAGTAGCAACAATTTCTGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017407.1-2041s1c1
Sequence:CCGGGCCCATTTAGAGGACTGTAAACTCGAGTTTACAGTCCTCTAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017407.1-582s1c1
Sequence:CCGGCCTAACAGAAATTGTTGCTATCTCGAGATAGCAACAATTTCTGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017407.1-3405s1c1
Sequence:CCGGGCGCTCTGACACAGAGTTAAACTCGAGTTTAACTCTGTGTCAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017407.1-2050s21c1
Sequence:CCGGGAGGACTGTAAAGGTCAAATCCTCGAGGATTTGACCTTTACAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017407.1-1382s21c1
Sequence:CCGGGGGTCACTAAGACACCTAAACCTCGAGGTTTAGGTGTCTTAGTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017407.1-397s21c1
Sequence:CCGGGACCCAAGAGATGATAGTATACTCGAGTATACTATCATCTCTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017407.1-604s21c1
Sequence:CCGGAGGCCCGAGCAACCTACATTTCTCGAGAAATGTAGGTTGCTCGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017407.1-3614s21c1
Sequence:CCGGCCAGGAATTTGGGAACCTAACCTCGAGGTTAGGTTCCCAAATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017407
VALIDATED
SPAG5 MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120642    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017407.1-3613s1c1
Sequence:CCGGCCCAGGAATTTGGGAACCTAACTCGAGTTAGGTTCCCAAATTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017407.1-581s1c1
Sequence:CCGGGCCTAACAGAAATTGTTGCTACTCGAGTAGCAACAATTTCTGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017407.1-2041s1c1
Sequence:CCGGGCCCATTTAGAGGACTGTAAACTCGAGTTTACAGTCCTCTAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017407.1-582s1c1
Sequence:CCGGCCTAACAGAAATTGTTGCTATCTCGAGATAGCAACAATTTCTGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017407.1-3405s1c1
Sequence:CCGGGCGCTCTGACACAGAGTTAAACTCGAGTTTAACTCTGTGTCAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017407.1-2050s21c1
Sequence:CCGGGAGGACTGTAAAGGTCAAATCCTCGAGGATTTGACCTTTACAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017407.1-1382s21c1
Sequence:CCGGGGGTCACTAAGACACCTAAACCTCGAGGTTTAGGTGTCTTAGTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017407.1-397s21c1
Sequence:CCGGGACCCAAGAGATGATAGTATACTCGAGTATACTATCATCTCTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017407.1-604s21c1
Sequence:CCGGAGGCCCGAGCAACCTACATTTCTCGAGAAATGTAGGTTGCTCGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017407.1-3614s21c1
Sequence:CCGGCCAGGAATTTGGGAACCTAACCTCGAGGTTAGGTTCCCAAATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017407
VALIDATED
SPAG5 MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120642    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017407.1-3613s1c1
Sequence:CCGGCCCAGGAATTTGGGAACCTAACTCGAGTTAGGTTCCCAAATTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017407.1-581s1c1
Sequence:CCGGGCCTAACAGAAATTGTTGCTACTCGAGTAGCAACAATTTCTGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017407.1-2041s1c1
Sequence:CCGGGCCCATTTAGAGGACTGTAAACTCGAGTTTACAGTCCTCTAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017407.1-582s1c1
Sequence:CCGGCCTAACAGAAATTGTTGCTATCTCGAGATAGCAACAATTTCTGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017407.1-3405s1c1
Sequence:CCGGGCGCTCTGACACAGAGTTAAACTCGAGTTTAACTCTGTGTCAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017407.1-2050s21c1
Sequence:CCGGGAGGACTGTAAAGGTCAAATCCTCGAGGATTTGACCTTTACAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017407.1-1382s21c1
Sequence:CCGGGGGTCACTAAGACACCTAAACCTCGAGGTTTAGGTGTCTTAGTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017407.1-397s21c1
Sequence:CCGGGACCCAAGAGATGATAGTATACTCGAGTATACTATCATCTCTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017407.1-604s21c1
Sequence:CCGGAGGCCCGAGCAACCTACATTTCTCGAGAAATGTAGGTTGCTCGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017407.1-3614s21c1
Sequence:CCGGCCAGGAATTTGGGAACCTAACCTCGAGGTTAGGTTCCCAAATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006461
VALIDATED
SPAG5 MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 5
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006461.2-3921s1c1
Sequence:CCGGCCAGAATCTGCTTCACCTCTTCTCGAGAAGAGGTGAAGCAGATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_006461.2-2273s1c1
Sequence:CCGGCCATGCAACTGGATTATACAACTCGAGTTGTATAATCCAGTTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006461.2-651s1c1
Sequence:CCGGCCAAATTAGCTCTACTCCTAACTCGAGTTAGGAGTAGAGCTAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006461.2-1021s1c1
Sequence:CCGGGAGGACTTAGTACCTTCTGAACTCGAGTTCAGAAGGTACTAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006461.2-3922s1c1
Sequence:CCGGCAGAATCTGCTTCACCTCTTTCTCGAGAAAGAGGTGAAGCAGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006461.2-3176s1c1
Sequence:CCGGCCCGAGTAGCATCAATGGTTTCTCGAGAAACCATTGATGCTACTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006461.2-1096s1c1
Sequence:CCGGGCAGCAGATTTCCGTGTCAATCTCGAGATTGACACGGAAATCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006461.2-2737s1c1
Sequence:CCGGGAGTTTGCAGACCAGGAGAATCTCGAGATTCTCCTGGTCTGCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006461.2-3784s1c1
Sequence:CCGGCGCTCTGACAAGGAGTTAGAACTCGAGTTCTAACTCCTTGTCAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006461.3-410s21c1
Sequence:CCGGCCAAATTAGCTCTACTCCTAACTCGAGTTAGGAGTAGAGCTAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006461.3-448s21c1
Sequence:CCGGTAGACCCACTGGGCAATTATACTCGAGTATAATTGCCCAGTGGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006461.3-3687s21c1
Sequence:CCGGCAGAATCTGCTTCACCTCTTTCTCGAGAAAGAGGTGAAGCAGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006461.3-2502s21c1
Sequence:CCGGGAGTTTGCAGACCAGGAGAATCTCGAGATTCTCCTGGTCTGCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006461
VALIDATED
SPAG5 MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 5
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006461.2-3921s1c1
Sequence:CCGGCCAGAATCTGCTTCACCTCTTCTCGAGAAGAGGTGAAGCAGATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_006461.2-2273s1c1
Sequence:CCGGCCATGCAACTGGATTATACAACTCGAGTTGTATAATCCAGTTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006461.2-651s1c1
Sequence:CCGGCCAAATTAGCTCTACTCCTAACTCGAGTTAGGAGTAGAGCTAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006461.2-1021s1c1
Sequence:CCGGGAGGACTTAGTACCTTCTGAACTCGAGTTCAGAAGGTACTAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006461.2-3922s1c1
Sequence:CCGGCAGAATCTGCTTCACCTCTTTCTCGAGAAAGAGGTGAAGCAGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006461.2-3176s1c1
Sequence:CCGGCCCGAGTAGCATCAATGGTTTCTCGAGAAACCATTGATGCTACTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006461.2-1096s1c1
Sequence:CCGGGCAGCAGATTTCCGTGTCAATCTCGAGATTGACACGGAAATCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006461.2-2737s1c1
Sequence:CCGGGAGTTTGCAGACCAGGAGAATCTCGAGATTCTCCTGGTCTGCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006461.2-3784s1c1
Sequence:CCGGCGCTCTGACAAGGAGTTAGAACTCGAGTTCTAACTCCTTGTCAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006461.3-410s21c1
Sequence:CCGGCCAAATTAGCTCTACTCCTAACTCGAGTTAGGAGTAGAGCTAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006461.3-448s21c1
Sequence:CCGGTAGACCCACTGGGCAATTATACTCGAGTATAATTGCCCAGTGGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006461.3-3687s21c1
Sequence:CCGGCAGAATCTGCTTCACCTCTTTCTCGAGAAAGAGGTGAAGCAGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006461.3-2502s21c1
Sequence:CCGGGAGTTTGCAGACCAGGAGAATCTCGAGATTCTCCTGGTCTGCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006461
VALIDATED
SPAG5 MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 5
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006461.2-3921s1c1
Sequence:CCGGCCAGAATCTGCTTCACCTCTTCTCGAGAAGAGGTGAAGCAGATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_006461.2-2273s1c1
Sequence:CCGGCCATGCAACTGGATTATACAACTCGAGTTGTATAATCCAGTTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006461.2-651s1c1
Sequence:CCGGCCAAATTAGCTCTACTCCTAACTCGAGTTAGGAGTAGAGCTAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006461.2-1021s1c1
Sequence:CCGGGAGGACTTAGTACCTTCTGAACTCGAGTTCAGAAGGTACTAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006461.2-3922s1c1
Sequence:CCGGCAGAATCTGCTTCACCTCTTTCTCGAGAAAGAGGTGAAGCAGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006461.2-3176s1c1
Sequence:CCGGCCCGAGTAGCATCAATGGTTTCTCGAGAAACCATTGATGCTACTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006461.2-1096s1c1
Sequence:CCGGGCAGCAGATTTCCGTGTCAATCTCGAGATTGACACGGAAATCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006461.2-2737s1c1
Sequence:CCGGGAGTTTGCAGACCAGGAGAATCTCGAGATTCTCCTGGTCTGCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006461.2-3784s1c1
Sequence:CCGGCGCTCTGACAAGGAGTTAGAACTCGAGTTCTAACTCCTTGTCAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006461.3-410s21c1
Sequence:CCGGCCAAATTAGCTCTACTCCTAACTCGAGTTAGGAGTAGAGCTAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006461.3-448s21c1
Sequence:CCGGTAGACCCACTGGGCAATTATACTCGAGTATAATTGCCCAGTGGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006461.3-3687s21c1
Sequence:CCGGCAGAATCTGCTTCACCTCTTTCTCGAGAAAGAGGTGAAGCAGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006461.3-2502s21c1
Sequence:CCGGGAGTTTGCAGACCAGGAGAATCTCGAGATTCTCCTGGTCTGCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks