EMAIL THIS PAGE TO A FRIEND

SPAG6

sperm associated antigen 6

Synonyms: Repro-SA-1 pf16
Gene ID:
Human(9576) Summary: The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from an infertile man. This protein localizes to the tail of permeabilized human sperm and contains eight contiguous armadillo repeats, a motif known to mediate protein-protein interactions. Studies in mice suggest that this protein is involved in sperm flagellar motility and maintenance of the structural integrity of mature sperm. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(50525) sperm associated antigen 6
Rat(360747) sperm associated antigen 6
Zebrafish(431757) sperm associated antigen 6
dog(477978) sperm associated antigen 6
domestic cat(101096155) sperm associated antigen 6
chicken(420505) sperm associated antigen 6
domestic guinea pig(100724896) sperm associated antigen 6
naked mole-rat(101729190) sperm associated antigen 6
cow(539424) sperm associated antigen 6
sheep(101103745) sperm associated antigen 6
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015773 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015773 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015773 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012443 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012443 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012443 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063461 MISSION® esiRNA esiRNA human SPAG6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012443 Rosetta Predictions human pricing
NM_172242 Rosetta Predictions human pricing
NM_001034960 Rosetta Predictions rat pricing
NM_015773 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075662 predicted 987
2 SASI_Hs01_00075663 predicted 453
3 SASI_Hs01_00075664 predicted 581
4 SASI_Hs01_00075665 predicted 394
5 SASI_Hs01_00075666 predicted 705
6 SASI_Hs01_00075667 predicted 876
7 SASI_Hs01_00075668 predicted 950
8 SASI_Hs02_00344343 predicted 773
9 SASI_Hs01_00075669 predicted 990
10 SASI_Hs01_00075670 predicted 1025
11 SASI_Hs01_00075671 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105047 predicted 984
2 SASI_Hs01_00105048 predicted 457
3 SASI_Hs01_00105049 predicted 578
4 SASI_Hs01_00105050 predicted 395
5 SASI_Hs01_00105051 predicted 711
6 SASI_Hs01_00105052 predicted 878
7 SASI_Hs01_00105053 predicted 952
8 SASI_Hs02_00367956 predicted 775
9 SASI_Hs01_00105054 predicted 988
10 SASI_Hs01_00105055 predicted 1033
11 SASI_Hs01_00105056 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034960 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120215 predicted 1389
2 SASI_Rn01_00120216 predicted 1248
3 SASI_Rn01_00120217 predicted 937
4 SASI_Rn01_00120218 predicted 297
5 SASI_Rn01_00120219 predicted 1485
6 SASI_Rn01_00120220 predicted 1333
7 SASI_Rn02_00204149 predicted 1491
8 SASI_Rn01_00120223 predicted 1316
9 SASI_Rn01_00120224 predicted 1354
10 SASI_Rn02_00204150 predicted 1174
11 SASI_Rn01_00120221 predicted 863
12 SASI_Rn01_00120222 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015773 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025976 predicted 1366
2 SASI_Mm01_00025977 predicted 975
3 SASI_Mm01_00025978 predicted 1351
4 SASI_Mm01_00025979 predicted 1686
5 SASI_Mm02_00323113 predicted 1095
6 SASI_Mm01_00025981 predicted 1638
7 SASI_Mm01_00025982 predicted 896
8 SASI_Mm01_00025983 predicted 1286
9 SASI_Mm02_00323114 predicted 528
10 SASI_Mm02_00323115 predicted 535
11 SASI_Mm01_00025974 predicted 1437
12 SASI_Mm01_00025975 predicted 345
13 SASI_Mm01_00025980 predicted 709
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015773
SPAG6 MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015773.1-604s21c1
Sequence:CCGGTGTATCCAGGAGCCAGAAATTCTCGAGAATTTCTGGCTCCTGGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015773.1-1345s21c1
Sequence:CCGGTACGACGCACCTCCCAATATCCTCGAGGATATTGGGAGGTGCGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015773.1-107s21c1
Sequence:CCGGTGTTCGAGCAGTACCAGAAAGCTCGAGCTTTCTGGTACTGCTCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015773.1-1598s21c1
Sequence:CCGGCACTGTGAACAAAGCATATTTCTCGAGAAATATGCTTTGTTCACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015773.1-1741s21c1
Sequence:CCGGGGTTAGTGGCTGGACTATATGCTCGAGCATATAGTCCAGCCACTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015773.1-313s1c1
Sequence:CCGGGCAGTCGTGAAAGGTGACATTCTCGAGAATGTCACCTTTCACGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181723    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015773.1-1749s1c1
Sequence:CCGGGCTGGACTATATGAAGGACAACTCGAGTTGTCCTTCATATAGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015773.1-601s1c1
Sequence:CCGGCTTTGTATCCAGGAGCCAGAACTCGAGTTCTGGCTCCTGGATACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015773
SPAG6 MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015773.1-604s21c1
Sequence:CCGGTGTATCCAGGAGCCAGAAATTCTCGAGAATTTCTGGCTCCTGGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015773.1-1345s21c1
Sequence:CCGGTACGACGCACCTCCCAATATCCTCGAGGATATTGGGAGGTGCGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015773.1-107s21c1
Sequence:CCGGTGTTCGAGCAGTACCAGAAAGCTCGAGCTTTCTGGTACTGCTCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015773.1-1598s21c1
Sequence:CCGGCACTGTGAACAAAGCATATTTCTCGAGAAATATGCTTTGTTCACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015773.1-1741s21c1
Sequence:CCGGGGTTAGTGGCTGGACTATATGCTCGAGCATATAGTCCAGCCACTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015773.1-313s1c1
Sequence:CCGGGCAGTCGTGAAAGGTGACATTCTCGAGAATGTCACCTTTCACGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181723    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015773.1-1749s1c1
Sequence:CCGGGCTGGACTATATGAAGGACAACTCGAGTTGTCCTTCATATAGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015773.1-601s1c1
Sequence:CCGGCTTTGTATCCAGGAGCCAGAACTCGAGTTCTGGCTCCTGGATACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015773
SPAG6 MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015773.1-604s21c1
Sequence:CCGGTGTATCCAGGAGCCAGAAATTCTCGAGAATTTCTGGCTCCTGGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015773.1-1345s21c1
Sequence:CCGGTACGACGCACCTCCCAATATCCTCGAGGATATTGGGAGGTGCGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015773.1-107s21c1
Sequence:CCGGTGTTCGAGCAGTACCAGAAAGCTCGAGCTTTCTGGTACTGCTCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015773.1-1598s21c1
Sequence:CCGGCACTGTGAACAAAGCATATTTCTCGAGAAATATGCTTTGTTCACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015773.1-1741s21c1
Sequence:CCGGGGTTAGTGGCTGGACTATATGCTCGAGCATATAGTCCAGCCACTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015773.1-313s1c1
Sequence:CCGGGCAGTCGTGAAAGGTGACATTCTCGAGAATGTCACCTTTCACGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181723    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015773.1-1749s1c1
Sequence:CCGGGCTGGACTATATGAAGGACAACTCGAGTTGTCCTTCATATAGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015773.1-601s1c1
Sequence:CCGGCTTTGTATCCAGGAGCCAGAACTCGAGTTCTGGCTCCTGGATACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012443
SPAG6 MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012443.2-1349s1c1
Sequence:CCGGGCCATAAAGAATATCCTGCAACTCGAGTTGCAGGATATTCTTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012443.2-803s1c1
Sequence:CCGGCCTGATGCTAAATTGAAGCATCTCGAGATGCTTCAATTTAGCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142537    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012443.2-2386s1c1
Sequence:CCGGGCTCTGCTCATGAATGAACAACTCGAGTTGTTCATTCATGAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012443.2-578s1c1
Sequence:CCGGGCCTGGGCACTTAGATATATTCTCGAGAATATATCTAAGTGCCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012443.2-1103s1c1
Sequence:CCGGGCAGCTCATTCTGAGAACCTACTCGAGTAGGTTCTCAGAATGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012443.2-1117s1c1
Sequence:CCGGGAACCTAGCAATGGCAGTCATCTCGAGATGACTGCCATTGCTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012443.2-374s1c1
Sequence:CCGGGCTGTTGTGAAGTGCGACATTCTCGAGAATGTCGCACTTCACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141485    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012443.2-2441s1c1
Sequence:CCGGCGTCACTTTCCCAAGTTTCAACTCGAGTTGAAACTTGGGAAAGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012443.2-1265s1c1
Sequence:CCGGGCAGTCACAAATACTTTGCCACTCGAGTGGCAAAGTATTTGTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012443.2-725s1c1
Sequence:CCGGGCAAAGCATTCTCCAGAGTTACTCGAGTAACTCTGGAGAATGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012443
SPAG6 MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012443.2-1349s1c1
Sequence:CCGGGCCATAAAGAATATCCTGCAACTCGAGTTGCAGGATATTCTTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012443.2-803s1c1
Sequence:CCGGCCTGATGCTAAATTGAAGCATCTCGAGATGCTTCAATTTAGCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142537    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012443.2-2386s1c1
Sequence:CCGGGCTCTGCTCATGAATGAACAACTCGAGTTGTTCATTCATGAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012443.2-578s1c1
Sequence:CCGGGCCTGGGCACTTAGATATATTCTCGAGAATATATCTAAGTGCCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012443.2-1103s1c1
Sequence:CCGGGCAGCTCATTCTGAGAACCTACTCGAGTAGGTTCTCAGAATGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012443.2-1117s1c1
Sequence:CCGGGAACCTAGCAATGGCAGTCATCTCGAGATGACTGCCATTGCTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012443.2-374s1c1
Sequence:CCGGGCTGTTGTGAAGTGCGACATTCTCGAGAATGTCGCACTTCACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141485    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012443.2-2441s1c1
Sequence:CCGGCGTCACTTTCCCAAGTTTCAACTCGAGTTGAAACTTGGGAAAGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012443.2-1265s1c1
Sequence:CCGGGCAGTCACAAATACTTTGCCACTCGAGTGGCAAAGTATTTGTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012443.2-725s1c1
Sequence:CCGGGCAAAGCATTCTCCAGAGTTACTCGAGTAACTCTGGAGAATGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012443
SPAG6 MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012443.2-1349s1c1
Sequence:CCGGGCCATAAAGAATATCCTGCAACTCGAGTTGCAGGATATTCTTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012443.2-803s1c1
Sequence:CCGGCCTGATGCTAAATTGAAGCATCTCGAGATGCTTCAATTTAGCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142537    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012443.2-2386s1c1
Sequence:CCGGGCTCTGCTCATGAATGAACAACTCGAGTTGTTCATTCATGAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012443.2-578s1c1
Sequence:CCGGGCCTGGGCACTTAGATATATTCTCGAGAATATATCTAAGTGCCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012443.2-1103s1c1
Sequence:CCGGGCAGCTCATTCTGAGAACCTACTCGAGTAGGTTCTCAGAATGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012443.2-1117s1c1
Sequence:CCGGGAACCTAGCAATGGCAGTCATCTCGAGATGACTGCCATTGCTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012443.2-374s1c1
Sequence:CCGGGCTGTTGTGAAGTGCGACATTCTCGAGAATGTCGCACTTCACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141485    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012443.2-2441s1c1
Sequence:CCGGCGTCACTTTCCCAAGTTTCAACTCGAGTTGAAACTTGGGAAAGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012443.2-1265s1c1
Sequence:CCGGGCAGTCACAAATACTTTGCCACTCGAGTGGCAAAGTATTTGTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012443.2-725s1c1
Sequence:CCGGGCAAAGCATTCTCCAGAGTTACTCGAGTAACTCTGGAGAATGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks