EMAIL THIS PAGE TO A FRIEND

SPAG7

sperm associated antigen 7

Synonyms: ACRP FSA-1
UniProtKB ID: O75391, Q96EU5
Gene ID:
Mouse(216873) sperm associated antigen 7
Rat(303260) sperm associated antigen 7
domestic guinea pig(100724361) sperm associated antigen 7
naked mole-rat(101723171) sperm associated antigen 7
cow(515086) sperm associated antigen 7
sheep(101109106) sperm associated antigen 7
Zebrafish(394100) sperm associated antigen 7
domestic cat(101090909) sperm associated antigen 7
dog(479468) sperm associated antigen 7
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172561 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172561 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172561 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004890 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004890 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004890 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004890 Rosetta Predictions human pricing
NM_001107016 Rosetta Predictions rat pricing
NM_172561 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079659 predicted 566
2 SASI_Hs01_00079660 predicted 646
3 SASI_Hs01_00079661 predicted 336
4 SASI_Hs01_00079663 predicted 505
5 SASI_Hs01_00079664 predicted 330
6 SASI_Hs02_00338527 predicted 328
7 SASI_Hs01_00079665 predicted 239
8 SASI_Hs01_00079666 predicted 584
9 SASI_Hs01_00079667 predicted 332
10 SASI_Hs01_00079668 predicted 256
11 SASI_Hs01_00079662 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107016 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224656 predicted 626
2 SASI_Rn02_00224657 predicted 439
3 SASI_Rn02_00224658 predicted 368
4 SASI_Rn02_00224659 predicted 354
5 SASI_Rn02_00224660 predicted 635
6 SASI_Rn02_00224661 predicted 485
7 SASI_Rn02_00224662 predicted 455
8 SASI_Rn02_00224663 predicted 725
9 SASI_Rn02_00224664 predicted 604
10 SASI_Rn02_00224665 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172561 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048493 predicted 310
2 SASI_Mm01_00048494 predicted 501
3 SASI_Mm01_00048495 predicted 499
4 SASI_Mm01_00048496 predicted 247
5 SASI_Mm02_00344198 predicted 230
6 SASI_Mm01_00048497 predicted 307
7 SASI_Mm01_00048498 predicted 503
8 SASI_Mm01_00048499 predicted 232
9 SASI_Mm01_00048500 predicted 497
10 SASI_Mm01_00048501 predicted 305
11 SASI_Mm01_00048502 predicted 320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172561
SPAG7 MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172561.1-669s1c1
Sequence:CCGGGTGGTGAAGAGTTGCCAACTACTCGAGTAGTTGGCAACTCTTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172561.1-242s1c1
Sequence:CCGGGAGCGGAGCATACTACATGATCTCGAGATCATGTAGTATGCTCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172561.1-493s1c1
Sequence:CCGGCAGCGACAACAAGGACAAGTACTCGAGTACTTGTCCTTGTTGTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172561.2-825s1c1
Sequence:CCGGGAGGAGAAGCAAGTGTTTATCCTCGAGGATAAACACTTGCTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172561.2-617s21c1
Sequence:CCGGCCATAGAGGAGGCCATGAATGCTCGAGCATTCATGGCCTCCTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172561.2-221s21c1
Sequence:CCGGTTCAGCCTATGAACAAGATAGCTCGAGCTATCTTGTTCATAGGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172561.2-408s21c1
Sequence:CCGGTGAGGAGAAGCGGAAGCTAAACTCGAGTTTAGCTTCCGCTTCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172561.2-825s21c1
Sequence:CCGGGAGGAGAAGCAAGTGTTTATCCTCGAGGATAAACACTTGCTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172561.2-494s21c1
Sequence:CCGGGCGACAACAAGGACAAGTATACTCGAGTATACTTGTCCTTGTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172561
SPAG7 MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172561.1-669s1c1
Sequence:CCGGGTGGTGAAGAGTTGCCAACTACTCGAGTAGTTGGCAACTCTTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172561.1-242s1c1
Sequence:CCGGGAGCGGAGCATACTACATGATCTCGAGATCATGTAGTATGCTCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172561.1-493s1c1
Sequence:CCGGCAGCGACAACAAGGACAAGTACTCGAGTACTTGTCCTTGTTGTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172561.2-825s1c1
Sequence:CCGGGAGGAGAAGCAAGTGTTTATCCTCGAGGATAAACACTTGCTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172561.2-617s21c1
Sequence:CCGGCCATAGAGGAGGCCATGAATGCTCGAGCATTCATGGCCTCCTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172561.2-221s21c1
Sequence:CCGGTTCAGCCTATGAACAAGATAGCTCGAGCTATCTTGTTCATAGGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172561.2-408s21c1
Sequence:CCGGTGAGGAGAAGCGGAAGCTAAACTCGAGTTTAGCTTCCGCTTCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172561.2-825s21c1
Sequence:CCGGGAGGAGAAGCAAGTGTTTATCCTCGAGGATAAACACTTGCTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172561.2-494s21c1
Sequence:CCGGGCGACAACAAGGACAAGTATACTCGAGTATACTTGTCCTTGTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172561
SPAG7 MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172561.1-669s1c1
Sequence:CCGGGTGGTGAAGAGTTGCCAACTACTCGAGTAGTTGGCAACTCTTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172561.1-242s1c1
Sequence:CCGGGAGCGGAGCATACTACATGATCTCGAGATCATGTAGTATGCTCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172561.1-493s1c1
Sequence:CCGGCAGCGACAACAAGGACAAGTACTCGAGTACTTGTCCTTGTTGTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172561.2-825s1c1
Sequence:CCGGGAGGAGAAGCAAGTGTTTATCCTCGAGGATAAACACTTGCTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172561.2-617s21c1
Sequence:CCGGCCATAGAGGAGGCCATGAATGCTCGAGCATTCATGGCCTCCTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172561.2-221s21c1
Sequence:CCGGTTCAGCCTATGAACAAGATAGCTCGAGCTATCTTGTTCATAGGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172561.2-408s21c1
Sequence:CCGGTGAGGAGAAGCGGAAGCTAAACTCGAGTTTAGCTTCCGCTTCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172561.2-825s21c1
Sequence:CCGGGAGGAGAAGCAAGTGTTTATCCTCGAGGATAAACACTTGCTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172561.2-494s21c1
Sequence:CCGGGCGACAACAAGGACAAGTATACTCGAGTATACTTGTCCTTGTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004890
VALIDATED
SPAG7 MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 7
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004890.1-187s1c1
Sequence:CCGGCATTCAAGACAGTGGGCAGATCTCGAGATCTGCCCACTGTCTTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004890.1-356s1c1
Sequence:CCGGGAAGAGCTAGACTCTTACCGTCTCGAGACGGTAAGAGTCTAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004890.1-744s1c1
Sequence:CCGGGAGACAAGGCTGCTGCTATTACTCGAGTAATAGCAGCAGCCTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004890.1-351s1c1
Sequence:CCGGCAGATGAAGAGCTAGACTCTTCTCGAGAAGAGTCTAGCTCTTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004890.1-631s1c1
Sequence:CCGGGAATGAGATCAGAGCCAAGAACTCGAGTTCTTGGCTCTGATCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004890.1-169s1c1
Sequence:CCGGGAAGGAGGTGTCAGATTTCATCTCGAGATGAAATCTGACACCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004890.1-239s1c1
Sequence:CCGGGAGAGGAGCATACTACATGATCTCGAGATCATGTAGTATGCTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004890.2-192s21c1
Sequence:CCGGGAAGGAGGTGTCAGATTTCATCTCGAGATGAAATCTGACACCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004890.2-374s21c1
Sequence:CCGGCAGATGAAGAGCTAGACTCTTCTCGAGAAGAGTCTAGCTCTTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004890.2-768s21c1
Sequence:CCGGGAGACAAGGCTGCTGCTATTACTCGAGTAATAGCAGCAGCCTTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004890.2-262s21c1
Sequence:CCGGGAGAGGAGCATACTACATGATCTCGAGATCATGTAGTATGCTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004890
VALIDATED
SPAG7 MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 7
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004890.1-187s1c1
Sequence:CCGGCATTCAAGACAGTGGGCAGATCTCGAGATCTGCCCACTGTCTTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004890.1-356s1c1
Sequence:CCGGGAAGAGCTAGACTCTTACCGTCTCGAGACGGTAAGAGTCTAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004890.1-744s1c1
Sequence:CCGGGAGACAAGGCTGCTGCTATTACTCGAGTAATAGCAGCAGCCTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004890.1-351s1c1
Sequence:CCGGCAGATGAAGAGCTAGACTCTTCTCGAGAAGAGTCTAGCTCTTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004890.1-631s1c1
Sequence:CCGGGAATGAGATCAGAGCCAAGAACTCGAGTTCTTGGCTCTGATCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004890.1-169s1c1
Sequence:CCGGGAAGGAGGTGTCAGATTTCATCTCGAGATGAAATCTGACACCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004890.1-239s1c1
Sequence:CCGGGAGAGGAGCATACTACATGATCTCGAGATCATGTAGTATGCTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004890.2-192s21c1
Sequence:CCGGGAAGGAGGTGTCAGATTTCATCTCGAGATGAAATCTGACACCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004890.2-374s21c1
Sequence:CCGGCAGATGAAGAGCTAGACTCTTCTCGAGAAGAGTCTAGCTCTTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004890.2-768s21c1
Sequence:CCGGGAGACAAGGCTGCTGCTATTACTCGAGTAATAGCAGCAGCCTTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004890.2-262s21c1
Sequence:CCGGGAGAGGAGCATACTACATGATCTCGAGATCATGTAGTATGCTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004890
VALIDATED
SPAG7 MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 7
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004890.1-187s1c1
Sequence:CCGGCATTCAAGACAGTGGGCAGATCTCGAGATCTGCCCACTGTCTTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004890.1-356s1c1
Sequence:CCGGGAAGAGCTAGACTCTTACCGTCTCGAGACGGTAAGAGTCTAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004890.1-744s1c1
Sequence:CCGGGAGACAAGGCTGCTGCTATTACTCGAGTAATAGCAGCAGCCTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004890.1-351s1c1
Sequence:CCGGCAGATGAAGAGCTAGACTCTTCTCGAGAAGAGTCTAGCTCTTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004890.1-631s1c1
Sequence:CCGGGAATGAGATCAGAGCCAAGAACTCGAGTTCTTGGCTCTGATCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004890.1-169s1c1
Sequence:CCGGGAAGGAGGTGTCAGATTTCATCTCGAGATGAAATCTGACACCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004890.1-239s1c1
Sequence:CCGGGAGAGGAGCATACTACATGATCTCGAGATCATGTAGTATGCTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004890.2-192s21c1
Sequence:CCGGGAAGGAGGTGTCAGATTTCATCTCGAGATGAAATCTGACACCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004890.2-374s21c1
Sequence:CCGGCAGATGAAGAGCTAGACTCTTCTCGAGAAGAGTCTAGCTCTTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004890.2-768s21c1
Sequence:CCGGGAGACAAGGCTGCTGCTATTACTCGAGTAATAGCAGCAGCCTTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004890.2-262s21c1
Sequence:CCGGGAGAGGAGCATACTACATGATCTCGAGATCATGTAGTATGCTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks