EMAIL THIS PAGE TO A FRIEND

SPAG8

sperm associated antigen 8

Synonyms: BS-84 HSD-1 SMP1 SPAG3 hSMP-1
UniProtKB ID: Q99932, B4DY89, E9PDV6, Q12937, Q5TCV8, Q8WWB4
Gene ID:
Human(26206) Summary: The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein encoded by this gene is recognized by sperm agglutinating antibodies from an infertile woman. This protein is localized in germ cells of the testis at all stages of spermatogenesis and is localized to the acrosomal region of mature spermatozoa. This protein interacts with ACT (activator of CREM in testis) and may play a role in CREM (cAMP response element modulator)-ACT-mediated gene transcription during spermatogenesis. This protein may also play a role in spermatogenesis by regulating microtubule formation and cell division. Alternatively spliced variants that encode different protein isoforms have been described but the full-length sequences of only two have been determined. [provided by RefSeq, Jul 2012]
Mouse(433700) sperm associated antigen 8
Rat(362508) sperm associated antigen 8
Horse(100067719) sperm associated antigen 8
domestic cat(101088033) sperm associated antigen 8
dog(611954) sperm associated antigen 8
cow(514627) sperm associated antigen 8
sheep(101113200) sperm associated antigen 8
naked mole-rat(101712976) sperm associated antigen 8
domestic guinea pig(101787578) sperm associated antigen 8
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007463 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001007463 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001007463 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012436 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067481 MISSION® esiRNA esiRNA human SPAG8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039592 Rosetta Predictions human pricing
NM_172312 Rosetta Predictions human pricing
XM_001070081 Rosetta Predictions rat pricing
XM_342826 Rosetta Predictions rat pricing
NM_001007463 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131207 predicted 904
2 SASI_Hs01_00131208 predicted 912
3 SASI_Hs01_00131209 predicted 902
4 SASI_Hs01_00131210 predicted 983
5 SASI_Hs01_00131211 predicted 897
6 SASI_Hs01_00131212 predicted 994
7 SASI_Hs02_00308599 predicted 1051
8 SASI_Hs01_00131213 predicted 1112
9 SASI_Hs01_00131214 predicted 1135
10 SASI_Hs01_00131215 predicted 1138
11 SASI_Hs01_00131216 predicted 986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050830 predicted 912
2 SASI_Hs01_00050831 predicted 912
3 SASI_Hs01_00050832 predicted 911
4 SASI_Hs01_00050833 predicted 976
5 SASI_Hs01_00050834 predicted 894
6 SASI_Hs01_00050835 predicted 989
7 SASI_Hs02_00367968 predicted 1049
8 SASI_Hs01_00050836 predicted 1107
9 SASI_Hs01_00050837 predicted 1142
10 SASI_Hs01_00050838 predicted 1139
11 SASI_Hs01_00050839 predicted 981
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330377 predicted 976
2 SASI_Rn02_00330378 predicted 1005
3 SASI_Rn02_00330379 predicted 481
4 SASI_Rn02_00330380 predicted 1327
5 SASI_Rn02_00330381 predicted 398
6 SASI_Rn02_00330382 predicted 1089
7 SASI_Rn02_00330383 predicted 1351
8 SASI_Rn02_00330384 predicted 1096
9 SASI_Rn02_00330385 predicted 1546
10 SASI_Rn02_00330386 predicted 1467
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342826 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394841 predicted 1445
2 SASI_Rn02_00394842 predicted 1547
3 SASI_Rn02_00394843 predicted 1394
4 SASI_Rn02_00394844 predicted 1346
5 SASI_Rn02_00394845 predicted 1546
6 SASI_Rn02_00394846 predicted 1462
7 SASI_Rn02_00394847 predicted 1463
8 SASI_Rn02_00394848 predicted 1394
9 SASI_Rn02_00394849 predicted 1522
10 SASI_Rn02_00394850 predicted 1600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007463 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040310 predicted 247
2 SASI_Mm01_00040311 predicted 963
3 SASI_Mm01_00040312 predicted 673
4 SASI_Mm01_00040313 predicted 300
5 SASI_Mm01_00040314 predicted 314
6 SASI_Mm01_00040315 predicted 246
7 SASI_Mm01_00040316 predicted 837
8 SASI_Mm02_00286731 predicted 468
9 SASI_Mm01_00040317 predicted 239
10 SASI_Mm01_00040318 predicted 755
11 SASI_Mm01_00040319 predicted 991
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007463
SPAG8 MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007463.1-176s21c1
Sequence:CCGGGCCCTCTTCTGACAGTCTTTACTCGAGTAAAGACTGTCAGAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007463.1-677s21c1
Sequence:CCGGTGGAGTGAGAGGGCCATATAACTCGAGTTATATGGCCCTCTCACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007463.1-267s21c1
Sequence:CCGGATCCCTCAGGATCCCTGTAATCTCGAGATTACAGGGATCCTGAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007463.1-1035s21c1
Sequence:CCGGCTGCGACACCAGATCTGTAAACTCGAGTTTACAGATCTGGTGTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007463.1-836s21c1
Sequence:CCGGCACCAACCAGCTGGATCAAATCTCGAGATTTGATCCAGCTGGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007463.1-100s1c1
Sequence:CCGGCTGTTCCTTCTTCGAGTAGTACTCGAGTACTACTCGAAGAAGGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007463.1-845s1c1
Sequence:CCGGGCTGGATCAAATCCCTCCATTCTCGAGAATGGAGGGATTTGATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007463.1-445s1c1
Sequence:CCGGGTCTTGTCTCTGGACCTGATTCTCGAGAATCAGGTCCAGAGACAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007463.1-690s1c1
Sequence:CCGGCCATATAAACCTCCAGAACCTCTCGAGAGGTTCTGGAGGTTTATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007463.1-1043s1c1
Sequence:CCGGCCAGATCTGTAAAGAGGTGCACTCGAGTGCACCTCTTTACAGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007463
SPAG8 MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007463.1-176s21c1
Sequence:CCGGGCCCTCTTCTGACAGTCTTTACTCGAGTAAAGACTGTCAGAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007463.1-677s21c1
Sequence:CCGGTGGAGTGAGAGGGCCATATAACTCGAGTTATATGGCCCTCTCACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007463.1-267s21c1
Sequence:CCGGATCCCTCAGGATCCCTGTAATCTCGAGATTACAGGGATCCTGAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007463.1-1035s21c1
Sequence:CCGGCTGCGACACCAGATCTGTAAACTCGAGTTTACAGATCTGGTGTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007463.1-836s21c1
Sequence:CCGGCACCAACCAGCTGGATCAAATCTCGAGATTTGATCCAGCTGGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007463.1-100s1c1
Sequence:CCGGCTGTTCCTTCTTCGAGTAGTACTCGAGTACTACTCGAAGAAGGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007463.1-845s1c1
Sequence:CCGGGCTGGATCAAATCCCTCCATTCTCGAGAATGGAGGGATTTGATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007463.1-445s1c1
Sequence:CCGGGTCTTGTCTCTGGACCTGATTCTCGAGAATCAGGTCCAGAGACAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007463.1-690s1c1
Sequence:CCGGCCATATAAACCTCCAGAACCTCTCGAGAGGTTCTGGAGGTTTATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007463.1-1043s1c1
Sequence:CCGGCCAGATCTGTAAAGAGGTGCACTCGAGTGCACCTCTTTACAGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007463
SPAG8 MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007463.1-176s21c1
Sequence:CCGGGCCCTCTTCTGACAGTCTTTACTCGAGTAAAGACTGTCAGAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007463.1-677s21c1
Sequence:CCGGTGGAGTGAGAGGGCCATATAACTCGAGTTATATGGCCCTCTCACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007463.1-267s21c1
Sequence:CCGGATCCCTCAGGATCCCTGTAATCTCGAGATTACAGGGATCCTGAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007463.1-1035s21c1
Sequence:CCGGCTGCGACACCAGATCTGTAAACTCGAGTTTACAGATCTGGTGTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007463.1-836s21c1
Sequence:CCGGCACCAACCAGCTGGATCAAATCTCGAGATTTGATCCAGCTGGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007463.1-100s1c1
Sequence:CCGGCTGTTCCTTCTTCGAGTAGTACTCGAGTACTACTCGAAGAAGGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007463.1-845s1c1
Sequence:CCGGGCTGGATCAAATCCCTCCATTCTCGAGAATGGAGGGATTTGATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007463.1-445s1c1
Sequence:CCGGGTCTTGTCTCTGGACCTGATTCTCGAGAATCAGGTCCAGAGACAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007463.1-690s1c1
Sequence:CCGGCCATATAAACCTCCAGAACCTCTCGAGAGGTTCTGGAGGTTTATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007463.1-1043s1c1
Sequence:CCGGCCAGATCTGTAAAGAGGTGCACTCGAGTGCACCTCTTTACAGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012436
SPAG8 MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012436.2-457s1c1
Sequence:CCGGGCCCGTCTATGTTTCCTGTATCTCGAGATACAGGAAACATAGACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012436.2-833s1c1
Sequence:CCGGCAGAAACAACCACCTTGGGAACTCGAGTTCCCAAGGTGGTTGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012436.2-458s1c1
Sequence:CCGGCCCGTCTATGTTTCCTGTATTCTCGAGAATACAGGAAACATAGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012436.2-898s1c1
Sequence:CCGGCCCAGACATTAAAGGGAAGCTCTCGAGAGCTTCCCTTTAATGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012436.2-1337s1c1
Sequence:CCGGCAACCTGAGACCTTCTGGATACTCGAGTATCCAGAAGGTCTCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012436
SPAG8 MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012436.2-457s1c1
Sequence:CCGGGCCCGTCTATGTTTCCTGTATCTCGAGATACAGGAAACATAGACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012436.2-833s1c1
Sequence:CCGGCAGAAACAACCACCTTGGGAACTCGAGTTCCCAAGGTGGTTGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012436.2-458s1c1
Sequence:CCGGCCCGTCTATGTTTCCTGTATTCTCGAGAATACAGGAAACATAGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012436.2-898s1c1
Sequence:CCGGCCCAGACATTAAAGGGAAGCTCTCGAGAGCTTCCCTTTAATGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012436.2-1337s1c1
Sequence:CCGGCAACCTGAGACCTTCTGGATACTCGAGTATCCAGAAGGTCTCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012436
SPAG8 MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012436.2-457s1c1
Sequence:CCGGGCCCGTCTATGTTTCCTGTATCTCGAGATACAGGAAACATAGACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012436.2-833s1c1
Sequence:CCGGCAGAAACAACCACCTTGGGAACTCGAGTTCCCAAGGTGGTTGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012436.2-458s1c1
Sequence:CCGGCCCGTCTATGTTTCCTGTATTCTCGAGAATACAGGAAACATAGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012436.2-898s1c1
Sequence:CCGGCCCAGACATTAAAGGGAAGCTCTCGAGAGCTTCCCTTTAATGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012436.2-1337s1c1
Sequence:CCGGCAACCTGAGACCTTCTGGATACTCGAGTATCCAGAAGGTCTCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks