EMAIL THIS PAGE TO A FRIEND

SPAG9

sperm associated antigen 9

Synonyms: CT89 HLC-6 HLC4 JIP-4 JIP4 JLP PHET PIG6
Gene ID:
Human(9043) Summary: This gene encodes a member of the cancer testis antigen gene family. The encoded protein functions as a scaffold protein that structurally organizes mitogen-activated protein kinases and mediates c-Jun-terminal kinase signaling. This protein also binds to kinesin-1 and may be involved in microtubule-based membrane transport. This protein may play a role in tumor growth and development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
Mouse(70834) sperm associated antigen 9
Rat(360600) sperm associated antigen 9
domestic guinea pig(100726102) sperm associated antigen 9
naked mole-rat(101721304) sperm associated antigen 9
cow(540689) sperm associated antigen 9
sheep(101102913) sperm associated antigen 9
chicken(422095) sperm associated antigen 9
domestic cat(101088963) sperm associated antigen 9
dog(480557) sperm associated antigen 9
Horse(100070202) sperm associated antigen 9
169 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027569 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027569 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027569 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003971 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003971 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003971 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003971 Rosetta Predictions human pricing
NM_172345 Rosetta Predictions human pricing
NM_001108290 Rosetta Predictions rat pricing
NM_001025428 Rosetta Predictions mouse pricing
NM_001025429 Rosetta Predictions mouse pricing
NM_001025430 Rosetta Predictions mouse pricing
NM_027569 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194613 predicted 2546
2 SASI_Hs02_00336653 predicted 4099
3 SASI_Hs02_00336654 predicted 1880
4 SASI_Hs02_00336655 predicted 1206
5 SASI_Hs02_00336656 predicted 1056
6 SASI_Hs02_00336657 predicted 802
7 SASI_Hs02_00336658 predicted 3040
8 SASI_Hs02_00336659 predicted 3139
9 SASI_Hs02_00336660 predicted 2473
10 SASI_Hs01_00194622 predicted 2362
11 SASI_Hs01_00194614 predicted 907
12 SASI_Hs01_00194615 predicted 3005
13 SASI_Hs01_00194616 predicted 2944
14 SASI_Hs01_00194617 predicted 2174
15 SASI_Hs01_00194618 predicted 3028
16 SASI_Hs01_00194619 predicted 2855
17 SASI_Hs01_00194620 predicted 3015
18 SASI_Hs01_00194621 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139822 predicted 1674
2 SASI_Hs01_00139823 predicted 653
3 SASI_Hs01_00139824 predicted 2125
4 SASI_Hs01_00139825 predicted 2069
5 SASI_Hs01_00139826 predicted 1300
6 SASI_Hs01_00139827 predicted 2155
7 SASI_Hs01_00139828 predicted 1981
8 SASI_Hs01_00139829 predicted 2141
9 SASI_Hs01_00139830 predicted 693
10 SASI_Hs01_00139831 predicted 1489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108290 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237199 predicted 1882
2 SASI_Rn02_00237200 predicted 1890
3 SASI_Rn02_00237201 predicted 2285
4 SASI_Rn02_00237202 predicted 2153
5 SASI_Rn02_00237203 predicted 2397
6 SASI_Rn02_00237204 predicted 2280
7 SASI_Rn02_00237205 predicted 1965
8 SASI_Rn02_00237206 predicted 2346
9 SASI_Rn02_00237207 predicted 2282
10 SASI_Rn02_00237208 predicted 1950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025428 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145666 predicted 1991
2 SASI_Mm01_00145668 predicted 3152
3 SASI_Mm01_00145669 predicted 2181
4 SASI_Mm02_00287871 predicted 3180
5 SASI_Mm02_00287872 predicted 1813
6 SASI_Mm01_00145671 predicted 1199
7 SASI_Mm01_00145672 predicted 2036
8 SASI_Mm01_00145673 predicted 1840
9 SASI_Mm01_00145674 predicted 2387
10 SASI_Mm01_00145675 predicted 3072
11 SASI_Mm01_00145667 predicted 2791
12 SASI_Mm01_00145670 predicted 1549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025429 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154483 predicted 1987
2 SASI_Mm01_00154485 predicted 3145
3 SASI_Mm01_00154486 predicted 2179
4 SASI_Mm02_00287873 predicted 3178
5 SASI_Mm02_00287874 predicted 1805
6 SASI_Mm01_00154488 predicted 1202
7 SASI_Mm01_00154489 predicted 2036
8 SASI_Mm01_00154490 predicted 1840
9 SASI_Mm01_00154491 predicted 2384
10 SASI_Mm01_00154492 predicted 3076
11 SASI_Mm01_00154484 predicted 2788
12 SASI_Mm01_00154487 predicted 1552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025430 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027263 predicted 1978
2 SASI_Mm01_00027265 predicted 3136
3 SASI_Mm01_00027266 predicted 2166
4 SASI_Mm02_00287875 predicted 3166
5 SASI_Mm02_00287876 predicted 1798
6 SASI_Mm01_00027268 predicted 1191
7 SASI_Mm01_00027269 predicted 2022
8 SASI_Mm01_00027270 predicted 1830
9 SASI_Mm01_00027271 predicted 2373
10 SASI_Mm01_00027272 predicted 3064
11 SASI_Mm01_00027264 predicted 2777
12 SASI_Mm01_00027267 predicted 1532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027569 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177774 predicted 2430
2 SASI_Mm01_00177776 predicted 3579
3 SASI_Mm01_00177777 predicted 2616
4 SASI_Mm02_00332400 predicted 3619
5 SASI_Mm02_00332401 predicted 2247
6 SASI_Mm01_00177779 predicted 1639
7 SASI_Mm01_00177780 predicted 2471
8 SASI_Mm01_00177781 predicted 2271
9 SASI_Mm01_00177782 predicted 2819
10 SASI_Mm01_00177783 predicted 3510
11 SASI_Mm01_00177775 predicted 3229
12 SASI_Mm01_00177778 predicted 1986
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027569
VALIDATED
SPAG9 MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 9
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027569.1-761s1c1
Sequence:CCGGGTCCTATATCATTAGGGATTTCTCGAGAAATCCCTAATGATATAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027569.1-1803s1c1
Sequence:CCGGCTCTTCAAGTAATGCAACAAACTCGAGTTTGTTGCATTACTTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027569.1-3555s1c1
Sequence:CCGGCGTGAGGATAACAGCCCTTATCTCGAGATAAGGGCTGTTATCCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027569.1-4186s1c1
Sequence:CCGGCCACATAATAATGTGAGCATTCTCGAGAATGCTCACATTATTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027569.1-2917s1c1
Sequence:CCGGCCAGTGTTTCAGTCAAGTAATCTCGAGATTACTTGACTGAAACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027569.1-1165s1c1
Sequence:CCGGCCTGAATTGGATATGGACAAACTCGAGTTTGTCCATATCCAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027569.1-1802s1c1
Sequence:CCGGGCTCTTCAAGTAATGCAACAACTCGAGTTGTTGCATTACTTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215316    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027569.2-4542s1c1
Sequence:CCGGCACTAATAACAGACGGATTATCTCGAGATAATCCGTCTGTTATTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027569.2-6528s1c1
Sequence:CCGGGATAGGAAGTGCAGGTTAAATCTCGAGATTTAACCTGCACTTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027569
VALIDATED
SPAG9 MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 9
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027569.1-761s1c1
Sequence:CCGGGTCCTATATCATTAGGGATTTCTCGAGAAATCCCTAATGATATAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027569.1-1803s1c1
Sequence:CCGGCTCTTCAAGTAATGCAACAAACTCGAGTTTGTTGCATTACTTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027569.1-3555s1c1
Sequence:CCGGCGTGAGGATAACAGCCCTTATCTCGAGATAAGGGCTGTTATCCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027569.1-4186s1c1
Sequence:CCGGCCACATAATAATGTGAGCATTCTCGAGAATGCTCACATTATTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027569.1-2917s1c1
Sequence:CCGGCCAGTGTTTCAGTCAAGTAATCTCGAGATTACTTGACTGAAACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027569.1-1165s1c1
Sequence:CCGGCCTGAATTGGATATGGACAAACTCGAGTTTGTCCATATCCAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027569.1-1802s1c1
Sequence:CCGGGCTCTTCAAGTAATGCAACAACTCGAGTTGTTGCATTACTTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215316    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027569.2-4542s1c1
Sequence:CCGGCACTAATAACAGACGGATTATCTCGAGATAATCCGTCTGTTATTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027569.2-6528s1c1
Sequence:CCGGGATAGGAAGTGCAGGTTAAATCTCGAGATTTAACCTGCACTTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027569
VALIDATED
SPAG9 MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 9
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027569.1-761s1c1
Sequence:CCGGGTCCTATATCATTAGGGATTTCTCGAGAAATCCCTAATGATATAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027569.1-1803s1c1
Sequence:CCGGCTCTTCAAGTAATGCAACAAACTCGAGTTTGTTGCATTACTTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027569.1-3555s1c1
Sequence:CCGGCGTGAGGATAACAGCCCTTATCTCGAGATAAGGGCTGTTATCCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027569.1-4186s1c1
Sequence:CCGGCCACATAATAATGTGAGCATTCTCGAGAATGCTCACATTATTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027569.1-2917s1c1
Sequence:CCGGCCAGTGTTTCAGTCAAGTAATCTCGAGATTACTTGACTGAAACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027569.1-1165s1c1
Sequence:CCGGCCTGAATTGGATATGGACAAACTCGAGTTTGTCCATATCCAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027569.1-1802s1c1
Sequence:CCGGGCTCTTCAAGTAATGCAACAACTCGAGTTGTTGCATTACTTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215316    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027569.2-4542s1c1
Sequence:CCGGCACTAATAACAGACGGATTATCTCGAGATAATCCGTCTGTTATTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027569.2-6528s1c1
Sequence:CCGGGATAGGAAGTGCAGGTTAAATCTCGAGATTTAACCTGCACTTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003971
VALIDATED
SPAG9 MISSION shRNA Bacterial Glycerol Stock
sperm associated antigen 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003971.3-4102s1c1
Sequence:CCGGCCACATAATGTGTGAGCATTTCTCGAGAAATGCTCACACATTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003971.3-3643s1c1
Sequence:CCGGCCAGGGACATTTATACCCTATCTCGAGATAGGGTATAAATGTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003971.3-1852s1c1
Sequence:CCGGGCCTTTGATTTCCTTAGTGAACTCGAGTTCACTAAGGAAATCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003971.3-955s1c1
Sequence:CCGGGCGCCAAATAAATCAGAGATACTCGAGTATCTCTGATTTATTTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003971.3-434s1c1
Sequence:CCGGCCCGAGTGGAATCTTTAGAATCTCGAGATTCTAAAGATTCCACTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003971.3-4034s1c1
Sequence:CCGGCGTCTCTTCTGCATGGTTTATCTCGAGATAAACCATGCAGAAGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281191    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003971.5-4233s21c1
Sequence:CCGGCCACATAATGTGTGAGCATTTCTCGAGAAATGCTCACACATTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003971.5-4165s21c1
Sequence:CCGGCGTCTCTTCTGCATGGTTTATCTCGAGATAAACCATGCAGAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003971.5-565s21c1
Sequence:CCGGCCCGAGTGGAATCTTTAGAATCTCGAGATTCTAAAGATTCCACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_003971.5-1086s21c1
Sequence:CCGGGCGCCAAATAAATCAGAGATACTCGAGTATCTCTGATTTATTTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003971
VALIDATED
SPAG9 MISSION shRNA shRNA Plasmid DNA
sperm associated antigen 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003971.3-4102s1c1
Sequence:CCGGCCACATAATGTGTGAGCATTTCTCGAGAAATGCTCACACATTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003971.3-3643s1c1
Sequence:CCGGCCAGGGACATTTATACCCTATCTCGAGATAGGGTATAAATGTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003971.3-1852s1c1
Sequence:CCGGGCCTTTGATTTCCTTAGTGAACTCGAGTTCACTAAGGAAATCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003971.3-955s1c1
Sequence:CCGGGCGCCAAATAAATCAGAGATACTCGAGTATCTCTGATTTATTTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003971.3-434s1c1
Sequence:CCGGCCCGAGTGGAATCTTTAGAATCTCGAGATTCTAAAGATTCCACTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003971.3-4034s1c1
Sequence:CCGGCGTCTCTTCTGCATGGTTTATCTCGAGATAAACCATGCAGAAGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281191    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003971.5-4233s21c1
Sequence:CCGGCCACATAATGTGTGAGCATTTCTCGAGAAATGCTCACACATTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003971.5-4165s21c1
Sequence:CCGGCGTCTCTTCTGCATGGTTTATCTCGAGATAAACCATGCAGAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003971.5-565s21c1
Sequence:CCGGCCCGAGTGGAATCTTTAGAATCTCGAGATTCTAAAGATTCCACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_003971.5-1086s21c1
Sequence:CCGGGCGCCAAATAAATCAGAGATACTCGAGTATCTCTGATTTATTTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003971
VALIDATED
SPAG9 MISSION shRNA Lentiviral Transduction Particles
sperm associated antigen 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003971.3-4102s1c1
Sequence:CCGGCCACATAATGTGTGAGCATTTCTCGAGAAATGCTCACACATTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003971.3-3643s1c1
Sequence:CCGGCCAGGGACATTTATACCCTATCTCGAGATAGGGTATAAATGTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003971.3-1852s1c1
Sequence:CCGGGCCTTTGATTTCCTTAGTGAACTCGAGTTCACTAAGGAAATCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003971.3-955s1c1
Sequence:CCGGGCGCCAAATAAATCAGAGATACTCGAGTATCTCTGATTTATTTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003971.3-434s1c1
Sequence:CCGGCCCGAGTGGAATCTTTAGAATCTCGAGATTCTAAAGATTCCACTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003971.3-4034s1c1
Sequence:CCGGCGTCTCTTCTGCATGGTTTATCTCGAGATAAACCATGCAGAAGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281191    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003971.5-4233s21c1
Sequence:CCGGCCACATAATGTGTGAGCATTTCTCGAGAAATGCTCACACATTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003971.5-4165s21c1
Sequence:CCGGCGTCTCTTCTGCATGGTTTATCTCGAGATAAACCATGCAGAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003971.5-565s21c1
Sequence:CCGGCCCGAGTGGAATCTTTAGAATCTCGAGATTCTAAAGATTCCACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_003971.5-1086s21c1
Sequence:CCGGGCGCCAAATAAATCAGAGATACTCGAGTATCTCTGATTTATTTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks