EMAIL THIS PAGE TO A FRIEND

SPAM1

sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)

Synonyms: HYA1 HYAL1 HYAL3 HYAL5 PH-20 PH20 SPAG15
UniProtKB ID: P38567, Q8TC30
Gene ID:
Human(6677) Summary: Hyaluronidase degrades hyaluronic acid, a major structural proteoglycan found in extracellular matrices and basement membranes. Six members of the hyaluronidase family are clustered into two tightly linked groups on chromosome 3p21.3 and 7q31.3. This gene was previously referred to as HYAL1 and HYA1 and has since been assigned the official symbol SPAM1; another family member on chromosome 3p21.3 has been assigned HYAL1. This gene encodes a GPI-anchored enzyme located on the human sperm surface and inner acrosomal membrane. This multifunctional protein is a hyaluronidase that enables sperm to penetrate through the hyaluronic acid-rich cumulus cell layer surrounding the oocyte, a receptor that plays a role in hyaluronic acid induced cell signaling, and a receptor that is involved in sperm-zona pellucida adhesion. Abnormal expression of this gene in tumors has implicated this protein in degradation of basement membranes leading to tumor invasion and metastasis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Mouse(20690) sperm adhesion molecule 1
Rat(117037) sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)
Zebrafish(791203) sperm adhesion molecule 1
chicken(417749) sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)
Horse(100051243) sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)
domestic cat(101095731) sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)
dog(475211) sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)
cow(353352) sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)
naked mole-rat(101700218) sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)
Domestic Rabbit(100009391) sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)
domestic guinea pig(100135624) sperm adhesion molecule 1
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003117 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003117 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003117 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009241 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009241 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009241 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097321 MISSION® esiRNA esiRNA human SPAM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003117 Rosetta Predictions human pricing
NM_153189 Rosetta Predictions human pricing
NM_053967 Rosetta Predictions rat pricing
NM_001079875 Rosetta Predictions mouse pricing
NM_009241 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043771 predicted 981
2 SASI_Hs01_00043773 predicted 679
3 SASI_Hs01_00043775 predicted 448
4 SASI_Hs01_00043776 predicted 1352
5 SASI_Hs02_00335089 predicted 484
6 SASI_Hs01_00043777 predicted 921
7 SASI_Hs01_00043778 predicted 1297
8 SASI_Hs02_00335090 predicted 858
9 SASI_Hs01_00043779 predicted 588
10 SASI_Hs02_00335091 predicted 1086
11 SASI_Hs01_00043770 predicted 485
12 SASI_Hs01_00043772 predicted 1467
13 SASI_Hs01_00043774 predicted 1477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077299 predicted 989
2 SASI_Hs01_00077301 predicted 683
3 SASI_Hs01_00077303 predicted 456
4 SASI_Hs01_00077304 predicted 1360
5 SASI_Hs02_00367035 predicted 492
6 SASI_Hs01_00077305 predicted 927
7 SASI_Hs01_00077306 predicted 1300
8 SASI_Hs02_00367036 predicted 870
9 SASI_Hs01_00077307 predicted 603
10 SASI_Hs02_00367037 predicted 1096
11 SASI_Hs01_00077298 predicted 482
12 SASI_Hs01_00077300 predicted 1481
13 SASI_Hs01_00077302 predicted 1487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053967 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037980 predicted 1655
2 SASI_Rn02_00266943 predicted 1669
3 SASI_Rn01_00037982 predicted 683
4 SASI_Rn01_00037983 predicted 866
5 SASI_Rn01_00037984 predicted 485
6 SASI_Rn01_00037985 predicted 908
7 SASI_Rn01_00037986 predicted 999
8 SASI_Rn01_00037987 predicted 381
9 SASI_Rn01_00037988 predicted 1299
10 SASI_Rn01_00037989 predicted 948
11 SASI_Rn01_00037981 predicted 1648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079875 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293172 predicted 702
2 SASI_Mm02_00293173 predicted 684
3 SASI_Mm02_00293174 predicted 1526
4 SASI_Mm02_00293175 predicted 1402
5 SASI_Mm02_00293176 predicted 718
6 SASI_Mm02_00293177 predicted 833
7 SASI_Mm02_00293178 predicted 1504
8 SASI_Mm02_00293179 predicted 661
9 SASI_Mm02_00293180 predicted 794
10 SASI_Mm02_00293181 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009241 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193790 predicted 697
2 SASI_Mm01_00193791 predicted 680
3 SASI_Mm01_00193792 predicted 1521
4 SASI_Mm02_00315715 predicted 1402
5 SASI_Mm01_00193793 predicted 716
6 SASI_Mm01_00193794 predicted 830
7 SASI_Mm01_00193796 predicted 1502
8 SASI_Mm01_00193797 predicted 659
9 SASI_Mm02_00315716 predicted 785
10 SASI_Mm02_00315717 predicted 835
11 SASI_Mm01_00193795 predicted 508
12 SASI_Mm01_00193798 predicted 1489
13 SASI_Mm01_00193799 predicted 605
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003117
SPAM1 MISSION shRNA Bacterial Glycerol Stock
sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003117.3-2007s21c1
Sequence:CCGGACCAACATCCTTGGGTATTAACTCGAGTTAATACCCAAGGATGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003117.3-2150s21c1
Sequence:CCGGATCTGATGAAGCCTATCAATTCTCGAGAATTGATAGGCTTCATCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003117.3-1893s21c1
Sequence:CCGGAGTCTGGGATCAAGGTATTAGCTCGAGCTAATACCTTGATCCCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003117.3-647s1c1
Sequence:CCGGCCGGGCAAGGTGTTACAATATCTCGAGATATTGTAACACCTTGCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003117.3-1092s1c1
Sequence:CCGGCGGTTACAATGGAAGTTGCTTCTCGAGAAGCAACTTCCATTGTAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003117.3-686s1c1
Sequence:CCGGGCTACTATCCTTACATAGATTCTCGAGAATCTATGTAAGGATAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003117.3-1545s1c1
Sequence:CCGGGCAAGGAGTGTGTATAAGGAACTCGAGTTCCTTATACACACTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203409    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003117.3-1969s1c1
Sequence:CCGGCTTGGCTTACAGGAAATGAAACTCGAGTTTCATTTCCTGTAAGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186252    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003117.3-1994s1c1
Sequence:CCGGCATGACTATCATCACCAACATCTCGAGATGTTGGTGATGATAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003117.3-1419s1c1
Sequence:CCGGCCTCAGTATAATGCGAAGTATCTCGAGATACTTCGCATTATACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003117
SPAM1 MISSION shRNA shRNA Plasmid DNA
sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003117.3-2007s21c1
Sequence:CCGGACCAACATCCTTGGGTATTAACTCGAGTTAATACCCAAGGATGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003117.3-2150s21c1
Sequence:CCGGATCTGATGAAGCCTATCAATTCTCGAGAATTGATAGGCTTCATCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003117.3-1893s21c1
Sequence:CCGGAGTCTGGGATCAAGGTATTAGCTCGAGCTAATACCTTGATCCCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003117.3-647s1c1
Sequence:CCGGCCGGGCAAGGTGTTACAATATCTCGAGATATTGTAACACCTTGCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003117.3-1092s1c1
Sequence:CCGGCGGTTACAATGGAAGTTGCTTCTCGAGAAGCAACTTCCATTGTAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003117.3-686s1c1
Sequence:CCGGGCTACTATCCTTACATAGATTCTCGAGAATCTATGTAAGGATAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003117.3-1545s1c1
Sequence:CCGGGCAAGGAGTGTGTATAAGGAACTCGAGTTCCTTATACACACTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203409    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003117.3-1969s1c1
Sequence:CCGGCTTGGCTTACAGGAAATGAAACTCGAGTTTCATTTCCTGTAAGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186252    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003117.3-1994s1c1
Sequence:CCGGCATGACTATCATCACCAACATCTCGAGATGTTGGTGATGATAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003117.3-1419s1c1
Sequence:CCGGCCTCAGTATAATGCGAAGTATCTCGAGATACTTCGCATTATACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003117
SPAM1 MISSION shRNA Lentiviral Transduction Particles
sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003117.3-2007s21c1
Sequence:CCGGACCAACATCCTTGGGTATTAACTCGAGTTAATACCCAAGGATGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003117.3-2150s21c1
Sequence:CCGGATCTGATGAAGCCTATCAATTCTCGAGAATTGATAGGCTTCATCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003117.3-1893s21c1
Sequence:CCGGAGTCTGGGATCAAGGTATTAGCTCGAGCTAATACCTTGATCCCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003117.3-647s1c1
Sequence:CCGGCCGGGCAAGGTGTTACAATATCTCGAGATATTGTAACACCTTGCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003117.3-1092s1c1
Sequence:CCGGCGGTTACAATGGAAGTTGCTTCTCGAGAAGCAACTTCCATTGTAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003117.3-686s1c1
Sequence:CCGGGCTACTATCCTTACATAGATTCTCGAGAATCTATGTAAGGATAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003117.3-1545s1c1
Sequence:CCGGGCAAGGAGTGTGTATAAGGAACTCGAGTTCCTTATACACACTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203409    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003117.3-1969s1c1
Sequence:CCGGCTTGGCTTACAGGAAATGAAACTCGAGTTTCATTTCCTGTAAGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186252    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003117.3-1994s1c1
Sequence:CCGGCATGACTATCATCACCAACATCTCGAGATGTTGGTGATGATAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003117.3-1419s1c1
Sequence:CCGGCCTCAGTATAATGCGAAGTATCTCGAGATACTTCGCATTATACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009241
SPAM1 MISSION shRNA Bacterial Glycerol Stock
sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009241.1-1900s1c1
Sequence:CCGGGCCTCAGTAATTTGGGATTATCTCGAGATAATCCCAAATTACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009241.1-630s1c1
Sequence:CCGGAGCAGAACATTATGGAGGAATCTCGAGATTCCTCCATAATGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009241.1-1090s1c1
Sequence:CCGGCCATCTGTCTATTTGAAGAAACTCGAGTTTCTTCAAATAGACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009241.1-610s1c1
Sequence:CCGGCCTCACATAGATGCAAACCAACTCGAGTTGGTTTGCATCTATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009241.1-787s1c1
Sequence:CCGGCCTAAGGATAACTACAGGAATCTCGAGATTCCTGTAGTTATCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009241
SPAM1 MISSION shRNA shRNA Plasmid DNA
sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009241.1-1900s1c1
Sequence:CCGGGCCTCAGTAATTTGGGATTATCTCGAGATAATCCCAAATTACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009241.1-630s1c1
Sequence:CCGGAGCAGAACATTATGGAGGAATCTCGAGATTCCTCCATAATGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009241.1-1090s1c1
Sequence:CCGGCCATCTGTCTATTTGAAGAAACTCGAGTTTCTTCAAATAGACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009241.1-610s1c1
Sequence:CCGGCCTCACATAGATGCAAACCAACTCGAGTTGGTTTGCATCTATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009241.1-787s1c1
Sequence:CCGGCCTAAGGATAACTACAGGAATCTCGAGATTCCTGTAGTTATCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009241
SPAM1 MISSION shRNA Lentiviral Transduction Particles
sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009241.1-1900s1c1
Sequence:CCGGGCCTCAGTAATTTGGGATTATCTCGAGATAATCCCAAATTACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009241.1-630s1c1
Sequence:CCGGAGCAGAACATTATGGAGGAATCTCGAGATTCCTCCATAATGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009241.1-1090s1c1
Sequence:CCGGCCATCTGTCTATTTGAAGAAACTCGAGTTTCTTCAAATAGACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009241.1-610s1c1
Sequence:CCGGCCTCACATAGATGCAAACCAACTCGAGTTGGTTTGCATCTATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009241.1-787s1c1
Sequence:CCGGCCTAAGGATAACTACAGGAATCTCGAGATTCCTGTAGTTATCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks