EMAIL THIS PAGE TO A FRIEND

SPANXA1

sperm protein associated with the nucleus, X-linked, family member A1

Synonyms: CT11.1 NAP-X SPAN-Xa SPAN-Xb SPANX
Species: Human SPANXA1(30014)
UniProtKB ID: Q9NS26, Q5JWI0
Gene ID:
Human(30014) Summary: Temporally regulated transcription and translation of several testis-specific genes is required to initiate the series of molecular and morphological changes in the male germ cell lineage necessary for the formation of mature spermatozoa. This gene is a member of the SPANX family of cancer/testis-associated genes, which are located in a cluster on chromosome X. The SPANX genes encode differentially expressed testis-specific proteins that localize to various subcellular compartments. This particular gene maps to chromosome X in a head-to-head orientation with SPANX family member A2, which appears to be a duplication of the A1 locus. The protein encoded by this gene targets to the nucleus where it associates with nuclear vacuoles and the redundant nuclear envelope. Based on its association with these poorly characterized regions of the sperm nucleus, this protein provides a biochemical marker to study unique structures in spermatazoa while attempting to further define its role in spermatogenesis. [provided by RefSeq, Jul 2008]
3 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_377051 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_377051 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_377051 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_377051
SPANXA1 MISSION shRNA Bacterial Glycerol Stock
sperm protein associated with the nucleus, X-linked, family member A1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377051.1-355s1c1
Sequence:CCGGCGCTACAGGAGGAACTTTAAACTCGAGTTTAAAGTTCCTCCTGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377051.1-46s1c1
Sequence:CCGGGCTGAAACAACAGCAGCATTTCTCGAGAAATGCTGCTGTTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377051.1-61s1c1
Sequence:CCGGGCATTTGGTTTGCTCTACACCCTCGAGGGTGTAGAGCAAACCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377051.1-167s1c1
Sequence:CCGGCCACTGACATTGAAGAACCAACTCGAGTTGGTTCTTCAATGTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377051.1-56s1c1
Sequence:CCGGCAGCAGCATTTGGTTTGCTCTCTCGAGAGAGCAAACCAAATGCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_377051
SPANXA1 MISSION shRNA shRNA Plasmid DNA
sperm protein associated with the nucleus, X-linked, family member A1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377051.1-355s1c1
Sequence:CCGGCGCTACAGGAGGAACTTTAAACTCGAGTTTAAAGTTCCTCCTGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377051.1-46s1c1
Sequence:CCGGGCTGAAACAACAGCAGCATTTCTCGAGAAATGCTGCTGTTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377051.1-61s1c1
Sequence:CCGGGCATTTGGTTTGCTCTACACCCTCGAGGGTGTAGAGCAAACCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377051.1-167s1c1
Sequence:CCGGCCACTGACATTGAAGAACCAACTCGAGTTGGTTCTTCAATGTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377051.1-56s1c1
Sequence:CCGGCAGCAGCATTTGGTTTGCTCTCTCGAGAGAGCAAACCAAATGCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_377051
SPANXA1 MISSION shRNA Lentiviral Transduction Particles
sperm protein associated with the nucleus, X-linked, family member A1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377051.1-355s1c1
Sequence:CCGGCGCTACAGGAGGAACTTTAAACTCGAGTTTAAAGTTCCTCCTGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377051.1-46s1c1
Sequence:CCGGGCTGAAACAACAGCAGCATTTCTCGAGAAATGCTGCTGTTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377051.1-61s1c1
Sequence:CCGGGCATTTGGTTTGCTCTACACCCTCGAGGGTGTAGAGCAAACCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377051.1-167s1c1
Sequence:CCGGCCACTGACATTGAAGAACCAACTCGAGTTGGTTCTTCAATGTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377051.1-56s1c1
Sequence:CCGGCAGCAGCATTTGGTTTGCTCTCTCGAGAGAGCAAACCAAATGCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks