EMAIL THIS PAGE TO A FRIEND

SPANXA2

SPANX family, member A2

Synonyms: CT11.1 SPANX SPANX-A SPANXA
Species: Human SPANXA2(728712)
Gene ID:
Human(728712) Summary: Temporally regulated transcription and translation of several testis-specific genes is required to initiate the series of molecular and morphological changes in the male germ cell lineage necessary for the formation of mature spermatozoa. This gene is a member of the SPANX family of cancer/testis-associated genes, which are located in a cluster on chromosome X. The SPANX genes encode differentially expressed testis-specific proteins that localize to various subcellular compartments. This particular gene maps to chromosome X in a head-to-head orientation with SPANX family member A1 and appears to be a duplication of that locus. The protein encoded by this gene targets to the nucleus where it associates with nuclear vacuoles and the redundant nuclear envelope. Based on its association with these poorly characterized regions of the sperm nucleus, this protein provides a biochemical marker to study unique structures in spermatazoa while attempting to further define its role in spermatogenesis. [provided by RefSeq, Jul 2008]
3 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145662 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145662 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145662 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147841 MISSION® esiRNA esiRNA human SPANXA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145662
SPANXA2 MISSION shRNA Bacterial Glycerol Stock
SPANX family, member A2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000256887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145662.2-219s21c1
Sequence:CCGGTCGCTACAGGAGGAACTTTAACTCGAGTTAAAGTTCCTCCTGTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145662.2-194s21c1
Sequence:CCGGCTGAGTCCTCGACCATACTAGCTCGAGCTAGTATGGTCGAGGACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145662.2-111s21c1
Sequence:CCGGTTCCAACGAGGCCAACGAGATCTCGAGATCTCGTTGGCCTCGTTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145662.2-247s21c1
Sequence:CCGGTCTCCAGAGGAACTGCTGAATCTCGAGATTCAGCAGTTCCTCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145662
SPANXA2 MISSION shRNA shRNA Plasmid DNA
SPANX family, member A2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000256887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145662.2-219s21c1
Sequence:CCGGTCGCTACAGGAGGAACTTTAACTCGAGTTAAAGTTCCTCCTGTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145662.2-194s21c1
Sequence:CCGGCTGAGTCCTCGACCATACTAGCTCGAGCTAGTATGGTCGAGGACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145662.2-111s21c1
Sequence:CCGGTTCCAACGAGGCCAACGAGATCTCGAGATCTCGTTGGCCTCGTTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145662.2-247s21c1
Sequence:CCGGTCTCCAGAGGAACTGCTGAATCTCGAGATTCAGCAGTTCCTCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145662
SPANXA2 MISSION shRNA Lentiviral Transduction Particles
SPANX family, member A2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000256887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145662.2-219s21c1
Sequence:CCGGTCGCTACAGGAGGAACTTTAACTCGAGTTAAAGTTCCTCCTGTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145662.2-194s21c1
Sequence:CCGGCTGAGTCCTCGACCATACTAGCTCGAGCTAGTATGGTCGAGGACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145662.2-111s21c1
Sequence:CCGGTTCCAACGAGGCCAACGAGATCTCGAGATCTCGTTGGCCTCGTTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145662.2-247s21c1
Sequence:CCGGTCTCCAGAGGAACTGCTGAATCTCGAGATTCAGCAGTTCCTCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks