EMAIL THIS PAGE TO A FRIEND

SPANXB1

SPANX family, member B1

Synonyms: B1 CT11.2 SPANX-B SPANXB
Species: Human SPANXB1(728695)
UniProtKB ID: Q9NS25, B2RPP2, Q32WQ7, Q5JYZ7, Q8TAD5
Gene ID:
Human(728695) Summary: Temporally regulated transcription and translation of several testis-specific genes is required to initiate the series of molecular and morphological changes in the male germ cell lineage necessary for the formation of mature spermatozoa. This gene is a member of the SPANX family of cancer/testis-associated genes, which are located in a cluster on chromosome X. The SPANX genes encode differentially expressed testis-specific proteins that localize to various subcellular compartments. This particular gene maps to chromosome X in a head-to-tail orientation with SPANX family member B2, which appears to be a duplication of the B1 locus. The SPANXB genes are unique members of this gene family, since they contain an additional 18 nt in their coding region compared to the majority of family members. Although the protein encoded by this gene contains consensus nuclear localization signals, the major site for subcellular localization of expressed protein is in the cytoplasmic droplets of ejaculated spermatozoa. This protein provides a biochemical marker for studying the unique structures in spermatazoa, while attempting to further define its role in spermatogenesis. [provided by RefSeq, Jul 2008]
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032461 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032461 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032461 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117651 MISSION® esiRNA esiRNA human SPANXB2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032461 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218641 predicted 421
2 SASI_Hs01_00218642 predicted 181
3 SASI_Hs01_00218643 predicted 371
4 SASI_Hs01_00218644 predicted 423
5 SASI_Hs01_00218645 predicted 412
6 SASI_Hs01_00218647 predicted 426
7 SASI_Hs01_00218648 predicted 172
8 SASI_Hs01_00218649 predicted 352
9 SASI_Hs01_00218650 predicted 113
10 SASI_Hs02_00359900 predicted 162
11 SASI_Hs01_00218646 predicted 121
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032461
SPANXB1 MISSION shRNA Bacterial Glycerol Stock
SPANX family, member B1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032461.2-253s21c1
Sequence:CCGGATCTGAGTCCTCGACCATACTCTCGAGAGTATGGTCGAGGACTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032461.2-171s21c1
Sequence:CCGGAGGCCAATGAGGCCAACAAGACTCGAGTCTTGTTGGCCTCATTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032461.2-148s21c1
Sequence:CCGGCTGTGAATCCAACGAGGCCAACTCGAGTTGGCCTCGTTGGATTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032461.2-281s21c1
Sequence:CCGGCGCTACAGGAGGAACGTGAAACTCGAGTTTCACGTTCCTCCTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032461.2-221s21c1
Sequence:CCGGGACCCGCAACCTGCTCCTAAACTCGAGTTTAGGAGCAGGTTGCGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032461
SPANXB1 MISSION shRNA shRNA Plasmid DNA
SPANX family, member B1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032461.2-253s21c1
Sequence:CCGGATCTGAGTCCTCGACCATACTCTCGAGAGTATGGTCGAGGACTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032461.2-171s21c1
Sequence:CCGGAGGCCAATGAGGCCAACAAGACTCGAGTCTTGTTGGCCTCATTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032461.2-148s21c1
Sequence:CCGGCTGTGAATCCAACGAGGCCAACTCGAGTTGGCCTCGTTGGATTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032461.2-281s21c1
Sequence:CCGGCGCTACAGGAGGAACGTGAAACTCGAGTTTCACGTTCCTCCTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032461.2-221s21c1
Sequence:CCGGGACCCGCAACCTGCTCCTAAACTCGAGTTTAGGAGCAGGTTGCGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032461
SPANXB1 MISSION shRNA Lentiviral Transduction Particles
SPANX family, member B1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032461.2-253s21c1
Sequence:CCGGATCTGAGTCCTCGACCATACTCTCGAGAGTATGGTCGAGGACTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032461.2-171s21c1
Sequence:CCGGAGGCCAATGAGGCCAACAAGACTCGAGTCTTGTTGGCCTCATTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032461.2-148s21c1
Sequence:CCGGCTGTGAATCCAACGAGGCCAACTCGAGTTGGCCTCGTTGGATTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032461.2-281s21c1
Sequence:CCGGCGCTACAGGAGGAACGTGAAACTCGAGTTTCACGTTCCTCCTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032461.2-221s21c1
Sequence:CCGGGACCCGCAACCTGCTCCTAAACTCGAGTTTAGGAGCAGGTTGCGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks