EMAIL THIS PAGE TO A FRIEND

SPANXB2

SPANX family, member B2

Synonyms: SPANX SPANXB
Species: Human SPANXB2(100133171)
Gene ID:
Human(100133171) Summary: Temporally regulated transcription and translation of several testis-specific genes is required to initiate the series of molecular and morphological changes in the male germ cell lineage necessary for the formation of mature spermatozoa. This gene is a member of the SPANX family of cancer/testis-associated genes, which are located in a cluster on chromosome X. The SPANX genes encode differentially expressed testis-specific proteins that localize to various subcellular compartments. This particular gene maps to chromosome X in a head-to-tail orientation with SPANX family member B1 and appears to be a duplication of that locus. The SPANXB genes are unique members of this gene family, since they contain an additional 18 nt in their coding region compared to the majority of family members. Although the protein encoded by this gene contains consensus nuclear localization signals, the major site for subcellular localization of expressed protein is in the cytoplasmic droplets of ejaculated spermatozoa. This protein provides a biochemical marker for studying the unique structures in spermatazoa, while attempting to further define its role in spermatogenesis. [provided by RefSeq, Jul 2008]
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145664 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145664 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145664 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145664 Rosetta Predictions human pricing
XM_001713741 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181011 predicted 426
2 SASI_Hs01_00181012 predicted 177
3 SASI_Hs01_00181013 predicted 374
4 SASI_Hs01_00181014 predicted 424
5 SASI_Hs01_00181015 predicted 410
6 SASI_Hs01_00181017 predicted 421
7 SASI_Hs01_00181018 predicted 172
8 SASI_Hs01_00181019 predicted 357
9 SASI_Hs01_00181020 predicted 110
10 SASI_Hs02_00365286 predicted 161
11 SASI_Hs01_00181016 predicted 119
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00392869 predicted 426
2 SASI_Hs02_00392870 predicted 176
3 SASI_Hs02_00392871 predicted 372
4 SASI_Hs02_00392872 predicted 427
5 SASI_Hs02_00392873 predicted 411
6 SASI_Hs02_00392874 predicted 421
7 SASI_Hs02_00392875 predicted 167
8 SASI_Hs02_00392876 predicted 351
9 SASI_Hs02_00392877 predicted 110
10 SASI_Hs02_00392878 predicted 166
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145664
SPANXB2 MISSION shRNA Bacterial Glycerol Stock
SPANX family, member B2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000267651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145664.1-254s21c1
Sequence:CCGGTCTGAGTCCTCGACCATACTACTCGAGTAGTATGGTCGAGGACTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145664.1-220s21c1
Sequence:CCGGAGACCCGCAACCTGCTCCTAACTCGAGTTAGGAGCAGGTTGCGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145664.1-151s21c1
Sequence:CCGGTGAATCCAACGAGGCCAACGACTCGAGTCGTTGGCCTCGTTGGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145664.1-279s21c1
Sequence:CCGGTTCGCTACAGGAGGAACGTGACTCGAGTCACGTTCCTCCTGTAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145664
SPANXB2 MISSION shRNA shRNA Plasmid DNA
SPANX family, member B2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000267651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145664.1-254s21c1
Sequence:CCGGTCTGAGTCCTCGACCATACTACTCGAGTAGTATGGTCGAGGACTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145664.1-220s21c1
Sequence:CCGGAGACCCGCAACCTGCTCCTAACTCGAGTTAGGAGCAGGTTGCGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145664.1-151s21c1
Sequence:CCGGTGAATCCAACGAGGCCAACGACTCGAGTCGTTGGCCTCGTTGGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145664.1-279s21c1
Sequence:CCGGTTCGCTACAGGAGGAACGTGACTCGAGTCACGTTCCTCCTGTAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145664
SPANXB2 MISSION shRNA Lentiviral Transduction Particles
SPANX family, member B2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000267651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145664.1-254s21c1
Sequence:CCGGTCTGAGTCCTCGACCATACTACTCGAGTAGTATGGTCGAGGACTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145664.1-220s21c1
Sequence:CCGGAGACCCGCAACCTGCTCCTAACTCGAGTTAGGAGCAGGTTGCGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145664.1-151s21c1
Sequence:CCGGTGAATCCAACGAGGCCAACGACTCGAGTCGTTGGCCTCGTTGGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145664.1-279s21c1
Sequence:CCGGTTCGCTACAGGAGGAACGTGACTCGAGTCACGTTCCTCCTGTAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks