EMAIL THIS PAGE TO A FRIEND

SPANXC

SPANX family, member C

Synonyms: C CT11.3 CTp11 SPANX-C
Species: Human SPANXC(64663)
UniProtKB ID: Q9NY87, Q32WL9, Q5JX88
Gene ID:
Human(64663) Summary: Temporally regulated transcription and translation of several testis-specific genes is required to initiate the series of molecular and morphological changes in the male germ cell lineage necessary for the formation of mature spermatozoa. This gene is a member of the SPANX family, which is located in a gene cluster on chromosome X. The SPANX genes encode differentially expressed testis-specific proteins that localize to various subcellular compartments. This particular gene encodes a protein that localizes to the nucleus and is expressed in highly metastatic cell lines, making the protein a potential diagnostic and prognostic marker. The protein belongs to a family of cancer/testis antigens and represents a potential target for cancer immunotherapy. [provided by RefSeq, Jul 2008]
9 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022661 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022661 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022661 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152881 MISSION® esiRNA esiRNA human SPANXC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022661 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196366 predicted 106
2 SASI_Hs01_00196367 predicted 101
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022661
SPANXC MISSION shRNA Bacterial Glycerol Stock
SPANX family, member C
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000258012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022661.2-103s21c1
Sequence:CCGGGTGAATCCAACGAGGTGAATGCTCGAGCATTCACCTCGTTGGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022661.2-118s21c1
Sequence:CCGGTGAATGAGACGATGCCGGAGACTCGAGTCTCCGGCATCGTCTCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022661.2-186s21c1
Sequence:CCGGACATCTGAGTCCTCGACCATACTCGAGTATGGTCGAGGACTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022661.2-244s21c1
Sequence:CCGGCTCCAGAGGAACTGCTGAATGCTCGAGCATTCAGCAGTTCCTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022661
SPANXC MISSION shRNA shRNA Plasmid DNA
SPANX family, member C
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000258012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022661.2-103s21c1
Sequence:CCGGGTGAATCCAACGAGGTGAATGCTCGAGCATTCACCTCGTTGGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022661.2-118s21c1
Sequence:CCGGTGAATGAGACGATGCCGGAGACTCGAGTCTCCGGCATCGTCTCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022661.2-186s21c1
Sequence:CCGGACATCTGAGTCCTCGACCATACTCGAGTATGGTCGAGGACTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022661.2-244s21c1
Sequence:CCGGCTCCAGAGGAACTGCTGAATGCTCGAGCATTCAGCAGTTCCTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022661
SPANXC MISSION shRNA Lentiviral Transduction Particles
SPANX family, member C
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000258012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022661.2-103s21c1
Sequence:CCGGGTGAATCCAACGAGGTGAATGCTCGAGCATTCACCTCGTTGGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022661.2-118s21c1
Sequence:CCGGTGAATGAGACGATGCCGGAGACTCGAGTCTCCGGCATCGTCTCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022661.2-186s21c1
Sequence:CCGGACATCTGAGTCCTCGACCATACTCGAGTATGGTCGAGGACTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022661.2-244s21c1
Sequence:CCGGCTCCAGAGGAACTGCTGAATGCTCGAGCATTCAGCAGTTCCTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks