EMAIL THIS PAGE TO A FRIEND

SPANXD

SPANX family, member D

Synonyms: CT11.4 SPANX-C SPANX-D dJ171K16.1
Species: Human SPANXD(64648)
UniProtKB ID: Q9BXN6, Q5JWI1
Gene ID:
Human(64648) Summary: Temporally regulated transcription and translation of several testis-specific genes is required to initiate the series of molecular and morphological changes in the male germ cell lineage necessary for the formation of mature spermatozoa. This gene is a member of the SPANX family of cancer/testis-associated genes, which are located in a cluster on chromosome X. The SPANX genes encode differentially expressed testis-specific proteins that localize to various subcellular compartments. This particular gene encodes a sperm protein that is associated with the nucleus but, although a role in spermatogenesis is suggested, the specific function of this family member has not yet been determined. [provided by RefSeq, Jul 2008]
3 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032417 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126831 MISSION® esiRNA esiRNA human SPANXD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032417
SPANXD MISSION shRNA Bacterial Glycerol Stock
SPANX family, member D
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000245486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032417.2-90s21c1
Sequence:CCGGCAACGAGGCCAACGAGATGATCTCGAGATCATCTCGTTGGCCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032417.2-194s21c1
Sequence:CCGGTTCGCTACAGGAGGAACTTTACTCGAGTAAAGTTCCTCCTGTAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032417.2-101s21c1
Sequence:CCGGACGAGATGATGCCGGAGACCTCTCGAGAGGTCTCCGGCATCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032417.2-124s21c1
Sequence:CCGGAGTGGGTACTCAGACCCGCAACTCGAGTTGCGGGTCTGAGTACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032417
SPANXD MISSION shRNA shRNA Plasmid DNA
SPANX family, member D
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000245486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032417.2-90s21c1
Sequence:CCGGCAACGAGGCCAACGAGATGATCTCGAGATCATCTCGTTGGCCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032417.2-194s21c1
Sequence:CCGGTTCGCTACAGGAGGAACTTTACTCGAGTAAAGTTCCTCCTGTAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032417.2-101s21c1
Sequence:CCGGACGAGATGATGCCGGAGACCTCTCGAGAGGTCTCCGGCATCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032417.2-124s21c1
Sequence:CCGGAGTGGGTACTCAGACCCGCAACTCGAGTTGCGGGTCTGAGTACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032417
SPANXD MISSION shRNA Lentiviral Transduction Particles
SPANX family, member D
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000245486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032417.2-90s21c1
Sequence:CCGGCAACGAGGCCAACGAGATGATCTCGAGATCATCTCGTTGGCCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032417.2-194s21c1
Sequence:CCGGTTCGCTACAGGAGGAACTTTACTCGAGTAAAGTTCCTCCTGTAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032417.2-101s21c1
Sequence:CCGGACGAGATGATGCCGGAGACCTCTCGAGAGGTCTCCGGCATCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032417.2-124s21c1
Sequence:CCGGAGTGGGTACTCAGACCCGCAACTCGAGTTGCGGGTCTGAGTACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks