EMAIL THIS PAGE TO A FRIEND

SPANXN1

SPANX family, member N1

Synonyms: CT11.6
Species: Human SPANXN1(494118)
UniProtKB ID: Q5VSR9
Gene ID:
Human(494118) Summary: This gene represents one of several duplicated family members that are located on chromosome X. This gene family encodes proteins that play a role in spermiogenesis. These proteins represent a specific subgroup of cancer/testis-associated antigens, and they may be candidates for tumor vaccines. This family member belongs to a subgroup of related genes that are present in all primates and rats and mice, and thus, it represents one of the ancestral family members. [provided by RefSeq, May 2010]
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001009614 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009614 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009614 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009614 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154521 predicted 351
2 SASI_Hs01_00154525 predicted 353
3 SASI_Hs01_00154523 predicted 363
4 SASI_Hs01_00154524 predicted 470
5 SASI_Hs01_00154527 predicted 458
6 SASI_Hs01_00154528 predicted 468
7 SASI_Hs02_00305681 predicted 542
8 SASI_Hs02_00305682 predicted 537
9 SASI_Hs01_00154522 predicted 925
10 SASI_Hs01_00154526 predicted 1215
11 SASI_Hs01_00154529 predicted 1222
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009614
SPANXN1 MISSION shRNA Bacterial Glycerol Stock
SPANX family, member N1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166003    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009614.1-1047s1c1
Sequence:CCGGGCAGGATGAAGACCTAGACTTCTCGAGAAGTCTAGGTCTTCATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009614.1-1033s1c1
Sequence:CCGGGAAGGATCTTCAAAGCAGGATCTCGAGATCCTGCTTTGAAGATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009614.1-841s1c1
Sequence:CCGGGAGACACCAAACAGGGACTTACTCGAGTAAGTCCCTGTTTGGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164590    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009614.1-1048s1c1
Sequence:CCGGCAGGATGAAGACCTAGACTTACTCGAGTAAGTCTAGGTCTTCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009614.1-946s1c1
Sequence:CCGGCATTCAAATCAACTGGAGAATCTCGAGATTCTCCAGTTGATTTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009614.1-806s1c1
Sequence:CCGGCCTGTGAATCCAACAATGAAACTCGAGTTTCATTGTTGGATTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162439    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009614.1-1122s1c1
Sequence:CCGGCTTACCTGAAGGATCTTCAAACTCGAGTTTGAAGATCCTTCAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009614
SPANXN1 MISSION shRNA shRNA Plasmid DNA
SPANX family, member N1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166003    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009614.1-1047s1c1
Sequence:CCGGGCAGGATGAAGACCTAGACTTCTCGAGAAGTCTAGGTCTTCATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009614.1-1033s1c1
Sequence:CCGGGAAGGATCTTCAAAGCAGGATCTCGAGATCCTGCTTTGAAGATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009614.1-841s1c1
Sequence:CCGGGAGACACCAAACAGGGACTTACTCGAGTAAGTCCCTGTTTGGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164590    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009614.1-1048s1c1
Sequence:CCGGCAGGATGAAGACCTAGACTTACTCGAGTAAGTCTAGGTCTTCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009614.1-946s1c1
Sequence:CCGGCATTCAAATCAACTGGAGAATCTCGAGATTCTCCAGTTGATTTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009614.1-806s1c1
Sequence:CCGGCCTGTGAATCCAACAATGAAACTCGAGTTTCATTGTTGGATTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162439    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009614.1-1122s1c1
Sequence:CCGGCTTACCTGAAGGATCTTCAAACTCGAGTTTGAAGATCCTTCAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009614
SPANXN1 MISSION shRNA Lentiviral Transduction Particles
SPANX family, member N1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166003    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009614.1-1047s1c1
Sequence:CCGGGCAGGATGAAGACCTAGACTTCTCGAGAAGTCTAGGTCTTCATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009614.1-1033s1c1
Sequence:CCGGGAAGGATCTTCAAAGCAGGATCTCGAGATCCTGCTTTGAAGATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009614.1-841s1c1
Sequence:CCGGGAGACACCAAACAGGGACTTACTCGAGTAAGTCCCTGTTTGGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164590    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009614.1-1048s1c1
Sequence:CCGGCAGGATGAAGACCTAGACTTACTCGAGTAAGTCTAGGTCTTCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009614.1-946s1c1
Sequence:CCGGCATTCAAATCAACTGGAGAATCTCGAGATTCTCCAGTTGATTTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009614.1-806s1c1
Sequence:CCGGCCTGTGAATCCAACAATGAAACTCGAGTTTCATTGTTGGATTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162439    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009614.1-1122s1c1
Sequence:CCGGCTTACCTGAAGGATCTTCAAACTCGAGTTTGAAGATCCTTCAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks