EMAIL THIS PAGE TO A FRIEND

SPANXN2

SPANX family, member N2

Synonyms: CT11.7 SPANX-N2
Species: Human SPANXN2(494119)
UniProtKB ID: Q5MJ10, Q0ZNM2
Gene ID:
7 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001009615 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009615 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009615 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126201 MISSION® esiRNA esiRNA human SPANXN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009615 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200473 predicted 1128
2 SASI_Hs01_00200474 predicted 1040
3 SASI_Hs01_00200475 predicted 1042
4 SASI_Hs01_00200476 predicted 890
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009615
SPANXN2 MISSION shRNA Bacterial Glycerol Stock
SPANX family, member N2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000166344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009615.1-1097s1c1
Sequence:CCGGCTGGACTCATCTGAAGGATCTCTCGAGAGATCCTTCAGATGAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009615.1-1052s1c1
Sequence:CCGGGAAGACCTGGACTCATCTGAACTCGAGTTCAGATGAGTCCAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009615.1-1063s1c1
Sequence:CCGGCTCATCTGAAGGATCTTCACACTCGAGTGTGAAGATCCTTCAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009615.1-1178s1c1
Sequence:CCGGGACTCATCTGAAGGATCTTCACTCGAGTGAAGATCCTTCAGATGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009615
SPANXN2 MISSION shRNA shRNA Plasmid DNA
SPANX family, member N2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000166344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009615.1-1097s1c1
Sequence:CCGGCTGGACTCATCTGAAGGATCTCTCGAGAGATCCTTCAGATGAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009615.1-1052s1c1
Sequence:CCGGGAAGACCTGGACTCATCTGAACTCGAGTTCAGATGAGTCCAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009615.1-1063s1c1
Sequence:CCGGCTCATCTGAAGGATCTTCACACTCGAGTGTGAAGATCCTTCAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009615.1-1178s1c1
Sequence:CCGGGACTCATCTGAAGGATCTTCACTCGAGTGAAGATCCTTCAGATGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009615
SPANXN2 MISSION shRNA Lentiviral Transduction Particles
SPANX family, member N2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000166344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009615.1-1097s1c1
Sequence:CCGGCTGGACTCATCTGAAGGATCTCTCGAGAGATCCTTCAGATGAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009615.1-1052s1c1
Sequence:CCGGGAAGACCTGGACTCATCTGAACTCGAGTTCAGATGAGTCCAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009615.1-1063s1c1
Sequence:CCGGCTCATCTGAAGGATCTTCACACTCGAGTGTGAAGATCCTTCAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009615.1-1178s1c1
Sequence:CCGGGACTCATCTGAAGGATCTTCACTCGAGTGAAGATCCTTCAGATGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks