EMAIL THIS PAGE TO A FRIEND

SPANXN3

SPANX family, member N3

Synonyms: CT11.8 SPANX-N3
Species: Human SPANXN3(139067)
UniProtKB ID: Q5MJ09, Q0ZNK4
Gene ID:
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001009609 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009609 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009609 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU222881 MISSION® esiRNA esiRNA targeting human SPANXN3 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009609 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197378 predicted 407
2 SASI_Hs01_00197380 predicted 198
3 SASI_Hs01_00197381 predicted 336
4 SASI_Hs01_00197383 predicted 551
5 SASI_Hs01_00197384 predicted 412
6 SASI_Hs01_00197385 predicted 417
7 SASI_Hs01_00197379 predicted 227
8 SASI_Hs01_00197382 predicted 232
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009609
SPANXN3 MISSION shRNA Bacterial Glycerol Stock
SPANX family, member N3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167517    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009609.1-555s1c1
Sequence:CCGGGATGGCGATGATTACAATAAACTCGAGTTTATTGTAATCATCGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009609.1-458s1c1
Sequence:CCGGGAGGATGAAGACCTAGGCTTACTCGAGTAAGCCTAGGTCTTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009609.2-342s21c1
Sequence:CCGGAGGACGAAGGCGTAGACTTATCTCGAGATAAGTCTACGCCTTCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009609.2-254s21c1
Sequence:CCGGTACCTCAGGAAGGGTAAGAAACTCGAGTTTCTTACCCTTCCTGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009609.2-383s21c1
Sequence:CCGGGATGAAGACCTAGGCCCATGTCTCGAGACATGGGCCTAGGTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009609.2-295s21c1
Sequence:CCGGGAATGAACAGTCCCAAGAGAACTCGAGTTCTCTTGGGACTGTTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009609.2-408s21c1
Sequence:CCGGGACCTTCAAAGGAGGACAAAGCTCGAGCTTTGTCCTCCTTTGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009609
SPANXN3 MISSION shRNA shRNA Plasmid DNA
SPANX family, member N3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167517    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009609.1-555s1c1
Sequence:CCGGGATGGCGATGATTACAATAAACTCGAGTTTATTGTAATCATCGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009609.1-458s1c1
Sequence:CCGGGAGGATGAAGACCTAGGCTTACTCGAGTAAGCCTAGGTCTTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009609.2-342s21c1
Sequence:CCGGAGGACGAAGGCGTAGACTTATCTCGAGATAAGTCTACGCCTTCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009609.2-254s21c1
Sequence:CCGGTACCTCAGGAAGGGTAAGAAACTCGAGTTTCTTACCCTTCCTGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009609.2-383s21c1
Sequence:CCGGGATGAAGACCTAGGCCCATGTCTCGAGACATGGGCCTAGGTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009609.2-295s21c1
Sequence:CCGGGAATGAACAGTCCCAAGAGAACTCGAGTTCTCTTGGGACTGTTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009609.2-408s21c1
Sequence:CCGGGACCTTCAAAGGAGGACAAAGCTCGAGCTTTGTCCTCCTTTGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009609
SPANXN3 MISSION shRNA Lentiviral Transduction Particles
SPANX family, member N3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167517    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009609.1-555s1c1
Sequence:CCGGGATGGCGATGATTACAATAAACTCGAGTTTATTGTAATCATCGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009609.1-458s1c1
Sequence:CCGGGAGGATGAAGACCTAGGCTTACTCGAGTAAGCCTAGGTCTTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009609.2-342s21c1
Sequence:CCGGAGGACGAAGGCGTAGACTTATCTCGAGATAAGTCTACGCCTTCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009609.2-254s21c1
Sequence:CCGGTACCTCAGGAAGGGTAAGAAACTCGAGTTTCTTACCCTTCCTGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009609.2-383s21c1
Sequence:CCGGGATGAAGACCTAGGCCCATGTCTCGAGACATGGGCCTAGGTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009609.2-295s21c1
Sequence:CCGGGAATGAACAGTCCCAAGAGAACTCGAGTTCTCTTGGGACTGTTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009609.2-408s21c1
Sequence:CCGGGACCTTCAAAGGAGGACAAAGCTCGAGCTTTGTCCTCCTTTGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks