EMAIL THIS PAGE TO A FRIEND

SPANXN4

SPANX family, member N4

Synonyms: CT11.9
UniProtKB ID: Q5MJ08, Q0ZNK6, Q5W0S6
Gene ID:
Human(441525) Summary: This gene represents one of several duplicated family members that are located on the X chromosome. This gene family encodes proteins that play a role in spermiogenesis. These proteins represent a specific subgroup of cancer/testis-associated antigens, and they may be candidates for tumor vaccines. This family member belongs to a subgroup of related genes that are present in all primates and rats and mice, and thus, it represents one of the ancestral family members. [provided by RefSeq, Sep 2009]
Mouse(73309) SPANX family, member N4
Rat(302832) SPANX family, member N4
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001009613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009613 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126041 MISSION® esiRNA esiRNA human SPANXN4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009613 Rosetta Predictions human pricing
XM_001055656 Rosetta Predictions rat pricing
XM_238631 Rosetta Predictions rat pricing
XM_001000096 Rosetta Predictions mouse pricing
XM_979066 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305675 predicted 205
2 SASI_Hs02_00305676 predicted 203
3 SASI_Hs02_00305677 predicted 314
4 SASI_Hs01_00224738 predicted 106
5 SASI_Hs02_00305678 predicted 314
6 SASI_Hs01_00224739 predicted 341
7 SASI_Hs01_00224745 predicted 307
8 SASI_Hs01_00224746 predicted 99
9 SASI_Hs02_00305679 predicted 379
10 SASI_Hs02_00305680 predicted 350
11 SASI_Hs01_00224740 predicted 20
12 SASI_Hs01_00224741 predicted 229
13 SASI_Hs01_00224742 predicted 222
14 SASI_Hs01_00224743 predicted 12
15 SASI_Hs01_00224744 predicted 9
16 SASI_Hs01_00224747 predicted 207
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280509 predicted 334
2 SASI_Rn02_00280510 predicted 359
3 SASI_Rn02_00280511 predicted 9
4 SASI_Rn02_00280512 predicted 340
5 SASI_Rn02_00280513 predicted 88
6 SASI_Rn02_00280514 predicted 7
7 SASI_Rn02_00280515 predicted 22
8 SASI_Rn02_00280516 predicted 51
9 SASI_Rn02_00280517 predicted 23
10 SASI_Rn02_00280518 predicted 132
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238631 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391446 predicted 331
2 SASI_Rn02_00391447 predicted 361
3 SASI_Rn02_00391448 predicted 10
4 SASI_Rn02_00391449 predicted 341
5 SASI_Rn02_00391450 predicted 94
6 SASI_Rn02_00391451 predicted 10
7 SASI_Rn02_00391452 predicted 16
8 SASI_Rn02_00391453 predicted 53
9 SASI_Rn02_00391454 predicted 15
10 SASI_Rn02_00391455 predicted 126
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000096 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00354597 predicted 36
2 SASI_Mm02_00354598 predicted 188
3 SASI_Mm02_00354599 predicted 203
4 SASI_Mm02_00354600 predicted 148
5 SASI_Mm02_00354601 predicted 185
6 SASI_Mm02_00354602 predicted 199
7 SASI_Mm02_00354603 predicted 30
8 SASI_Mm02_00354604 predicted 140
9 SASI_Mm02_00354605 predicted 39
10 SASI_Mm02_00354606 predicted 159
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979066 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260826 predicted 41
2 SASI_Mm01_00260830 predicted 183
3 SASI_Mm01_00260831 predicted 199
4 SASI_Mm01_00260833 predicted 144
5 SASI_Mm02_00446802 predicted 190
6 SASI_Mm02_00446803 predicted 200
7 SASI_Mm01_00260835 predicted 27
8 SASI_Mm02_00446804 predicted 139
9 SASI_Mm02_00446805 predicted 38
10 SASI_Mm02_00446806 predicted 158
11 SASI_Mm01_00260827 predicted 160
12 SASI_Mm01_00260828 predicted 487
13 SASI_Mm01_00260829 predicted 451
14 SASI_Mm01_00260832 predicted 476
15 SASI_Mm01_00260834 predicted 358
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009613
SPANXN4 MISSION shRNA Bacterial Glycerol Stock
SPANX family, member N4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009613.2-205s21c1
Sequence:CCGGCCCTGAACAGAGTTTGAAAGACTCGAGTCTTTCAAACTCTGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009613.2-259s21c1
Sequence:CCGGTTACTGCAGGAAGAATAAGAACTCGAGTTCTTATTCTTCCTGCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009613.2-177s21c1
Sequence:CCGGAGAAGAAGAATCTGCACAGAGCTCGAGCTCTGTGCAGATTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009613.2-213s21c1
Sequence:CCGGAGAGTTTGAAAGAGACAGAAACTCGAGTTTCTGTCTCTTTCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009613.2-169s21c1
Sequence:CCGGTGACAAGAAGAAGAAGAATCTCTCGAGAGATTCTTCTTCTTCTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009613.1-110s1c1
Sequence:CCGGCTGAACAGAGTTTGAAAGAGACTCGAGTCTCTTTCAAACTCTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009613.1-112s1c1
Sequence:CCGGGAACAGAGTTTGAAAGAGACACTCGAGTGTCTCTTTCAAACTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009613
SPANXN4 MISSION shRNA shRNA Plasmid DNA
SPANX family, member N4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009613.2-205s21c1
Sequence:CCGGCCCTGAACAGAGTTTGAAAGACTCGAGTCTTTCAAACTCTGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009613.2-259s21c1
Sequence:CCGGTTACTGCAGGAAGAATAAGAACTCGAGTTCTTATTCTTCCTGCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009613.2-177s21c1
Sequence:CCGGAGAAGAAGAATCTGCACAGAGCTCGAGCTCTGTGCAGATTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009613.2-213s21c1
Sequence:CCGGAGAGTTTGAAAGAGACAGAAACTCGAGTTTCTGTCTCTTTCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009613.2-169s21c1
Sequence:CCGGTGACAAGAAGAAGAAGAATCTCTCGAGAGATTCTTCTTCTTCTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009613.1-110s1c1
Sequence:CCGGCTGAACAGAGTTTGAAAGAGACTCGAGTCTCTTTCAAACTCTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009613.1-112s1c1
Sequence:CCGGGAACAGAGTTTGAAAGAGACACTCGAGTGTCTCTTTCAAACTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009613
SPANXN4 MISSION shRNA Lentiviral Transduction Particles
SPANX family, member N4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009613.2-205s21c1
Sequence:CCGGCCCTGAACAGAGTTTGAAAGACTCGAGTCTTTCAAACTCTGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009613.2-259s21c1
Sequence:CCGGTTACTGCAGGAAGAATAAGAACTCGAGTTCTTATTCTTCCTGCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009613.2-177s21c1
Sequence:CCGGAGAAGAAGAATCTGCACAGAGCTCGAGCTCTGTGCAGATTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009613.2-213s21c1
Sequence:CCGGAGAGTTTGAAAGAGACAGAAACTCGAGTTTCTGTCTCTTTCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009613.2-169s21c1
Sequence:CCGGTGACAAGAAGAAGAAGAATCTCTCGAGAGATTCTTCTTCTTCTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009613.1-110s1c1
Sequence:CCGGCTGAACAGAGTTTGAAAGAGACTCGAGTCTCTTTCAAACTCTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009613.1-112s1c1
Sequence:CCGGGAACAGAGTTTGAAAGAGACACTCGAGTGTCTCTTTCAAACTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks