EMAIL THIS PAGE TO A FRIEND

SPANXN5

SPANX family, member N5

Synonyms: CT11.10 SPANX-N5
Species: Human SPANXN5(494197)
UniProtKB ID: Q5MJ07
Gene ID:
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001009616 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009616 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009616 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009616 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212973 predicted 276
2 SASI_Hs02_00305683 predicted 318
3 SASI_Hs01_00212977 predicted 315
4 SASI_Hs01_00212979 predicted 317
5 SASI_Hs01_00212980 predicted 276
6 SASI_Hs01_00212974 predicted 94
7 SASI_Hs01_00212982 predicted 341
8 SASI_Hs01_00212976 predicted 90
9 SASI_Hs02_00305684 predicted 427
10 SASI_Hs01_00212978 predicted 147
11 SASI_Hs01_00212975 predicted 919
12 SASI_Hs01_00212981 predicted 909
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009616
SPANXN5 MISSION shRNA Bacterial Glycerol Stock
SPANX family, member N5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-852s1c1
Sequence:CCGGCTTAGTCCTCGAACCGAGTTTCTCGAGAAACTCGGTTCGAGGACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165502    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-910s1c1
Sequence:CCGGGTGTTGTGCTACAGGAAGACTCTCGAGAGTCTTCCTGTAGCACAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163276    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-1048s1c1
Sequence:CCGGGCAGAATCTTCAAAGCAGGATCTCGAGATCCTGCTTTGAAGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163090    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-912s1c1
Sequence:CCGGGTTGTGCTACAGGAAGACTAACTCGAGTTAGTCTTCCTGTAGCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161690    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-1051s1c1
Sequence:CCGGGAATCTTCAAAGCAGGATGAACTCGAGTTCATCCTGCTTTGAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160694    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-1063s1c1
Sequence:CCGGCAGGATGAAGACCTACAATTACTCGAGTAATTGTAGGTCTTCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161902    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-1069s1c1
Sequence:CCGGGAAGACCTACAATTACCTGAACTCGAGTTCAGGTAATTGTAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163195    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-1165s1c1
Sequence:CCGGGAAGGATCTTTGATGGAGGAACTCGAGTTCCTCCATCAAAGATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163385    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-915s1c1
Sequence:CCGGGTGCTACAGGAAGACTAAGAACTCGAGTTCTTAGTCTTCCTGTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163700    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-1147s1c1
Sequence:CCGGGAAGACCTAGACTCATCTGAACTCGAGTTCAGATGAGTCTAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009616
SPANXN5 MISSION shRNA shRNA Plasmid DNA
SPANX family, member N5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-852s1c1
Sequence:CCGGCTTAGTCCTCGAACCGAGTTTCTCGAGAAACTCGGTTCGAGGACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165502    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-910s1c1
Sequence:CCGGGTGTTGTGCTACAGGAAGACTCTCGAGAGTCTTCCTGTAGCACAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163276    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-1048s1c1
Sequence:CCGGGCAGAATCTTCAAAGCAGGATCTCGAGATCCTGCTTTGAAGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163090    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-912s1c1
Sequence:CCGGGTTGTGCTACAGGAAGACTAACTCGAGTTAGTCTTCCTGTAGCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161690    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-1051s1c1
Sequence:CCGGGAATCTTCAAAGCAGGATGAACTCGAGTTCATCCTGCTTTGAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160694    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-1063s1c1
Sequence:CCGGCAGGATGAAGACCTACAATTACTCGAGTAATTGTAGGTCTTCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161902    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-1069s1c1
Sequence:CCGGGAAGACCTACAATTACCTGAACTCGAGTTCAGGTAATTGTAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163195    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-1165s1c1
Sequence:CCGGGAAGGATCTTTGATGGAGGAACTCGAGTTCCTCCATCAAAGATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163385    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-915s1c1
Sequence:CCGGGTGCTACAGGAAGACTAAGAACTCGAGTTCTTAGTCTTCCTGTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163700    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-1147s1c1
Sequence:CCGGGAAGACCTAGACTCATCTGAACTCGAGTTCAGATGAGTCTAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009616
SPANXN5 MISSION shRNA Lentiviral Transduction Particles
SPANX family, member N5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-852s1c1
Sequence:CCGGCTTAGTCCTCGAACCGAGTTTCTCGAGAAACTCGGTTCGAGGACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165502    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-910s1c1
Sequence:CCGGGTGTTGTGCTACAGGAAGACTCTCGAGAGTCTTCCTGTAGCACAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163276    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-1048s1c1
Sequence:CCGGGCAGAATCTTCAAAGCAGGATCTCGAGATCCTGCTTTGAAGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163090    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-912s1c1
Sequence:CCGGGTTGTGCTACAGGAAGACTAACTCGAGTTAGTCTTCCTGTAGCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161690    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-1051s1c1
Sequence:CCGGGAATCTTCAAAGCAGGATGAACTCGAGTTCATCCTGCTTTGAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160694    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-1063s1c1
Sequence:CCGGCAGGATGAAGACCTACAATTACTCGAGTAATTGTAGGTCTTCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161902    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-1069s1c1
Sequence:CCGGGAAGACCTACAATTACCTGAACTCGAGTTCAGGTAATTGTAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163195    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-1165s1c1
Sequence:CCGGGAAGGATCTTTGATGGAGGAACTCGAGTTCCTCCATCAAAGATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163385    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-915s1c1
Sequence:CCGGGTGCTACAGGAAGACTAAGAACTCGAGTTCTTAGTCTTCCTGTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163700    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009616.1-1147s1c1
Sequence:CCGGGAAGACCTAGACTCATCTGAACTCGAGTTCAGATGAGTCTAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks