EMAIL THIS PAGE TO A FRIEND

SPARC

secreted protein, acidic, cysteine-rich (osteonectin)

Synonyms: ON
UniProtKB ID: P09486, D3DQH9, Q6IBK4
Gene ID:
Human(6678) Summary: This gene encodes a cysteine-rich acidic matrix-associated protein. The encoded protein is required for the collagen in bone to become calcified but is also involved in extracellular matrix synthesis and promotion of changes to cell shape. The gene product has been associated with tumor suppression but has also been correlated with metastasis based on changes to cell shape which can promote tumor cell invasion. [provided by RefSeq, Dec 2011]
Mouse(20692) secreted acidic cysteine rich glycoprotein
Rat(24791) secreted protein, acidic, cysteine-rich (osteonectin)
Zebrafish(321357) secreted acidic cysteine rich glycoprotein
Horse(100060119) secreted protein, acidic, cysteine-rich (osteonectin)
domestic cat(101099861) secreted protein, acidic, cysteine-rich (osteonectin)
dog(612159) secreted protein, acidic, cysteine-rich (osteonectin)
dog(595143) secreted protein, acidic, cysteine-rich (osteonectin)
chicken(386571) secreted protein, acidic, cysteine-rich (osteonectin)
domestic guinea pig(100725447) secreted protein, acidic, cysteine-rich (osteonectin)
Domestic Rabbit(100009355) secreted protein, acidic, cysteine-rich (osteonectin)
naked mole-rat(101697769) secreted protein, acidic, cysteine-rich (osteonectin)
cow(282077) secreted protein, acidic, cysteine-rich (osteonectin)
Goat(100860800) secreted protein, acidic, cysteine-rich (osteonectin)
sheep(100307048) secreted protein, acidic, cysteine-rich (osteonectin)
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009242 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009242 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009242 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003118 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003118 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003118 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003118 Rosetta Predictions human pricing
NM_012656 Rosetta Predictions rat pricing
NM_009242 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065300 predicted 527
2 SASI_Hs01_00065302 predicted 974
3 SASI_Hs01_00065304 predicted 235
4 SASI_Hs01_00065305 predicted 996
5 SASI_Hs01_00065308 predicted 1311
6 SASI_Hs01_00065309 predicted 1265
7 SASI_Hs02_00335092 predicted 251
8 SASI_Hs02_00335093 predicted 525
9 SASI_Hs02_00335094 predicted 1177
10 SASI_Hs02_00335095 predicted 218
11 SASI_Hs01_00065301 predicted 1123
12 SASI_Hs01_00065303 predicted 784
13 SASI_Hs01_00065306 predicted 1000
14 SASI_Hs01_00065307 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084580 predicted 449
2 SASI_Rn01_00084581 predicted 626
3 SASI_Rn01_00084582 predicted 859
4 SASI_Rn01_00084584 predicted 819
5 SASI_Rn01_00084585 predicted 284
6 SASI_Rn01_00084586 predicted 473
7 SASI_Rn01_00084587 predicted 412
8 SASI_Rn01_00084588 predicted 218
9 SASI_Rn01_00084589 predicted 590
10 SASI_Rn02_00259910 predicted 845
11 SASI_Rn01_00084583 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009242 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101826 predicted 878
2 SASI_Mm01_00101828 predicted 607
3 SASI_Mm01_00101829 predicted 517
4 SASI_Mm01_00101830 predicted 659
5 SASI_Mm01_00101831 predicted 728
6 SASI_Mm01_00101832 predicted 1651
7 SASI_Mm02_00315718 predicted 611
8 SASI_Mm01_00101833 predicted 540
9 SASI_Mm01_00101834 predicted 730
10 SASI_Mm01_00101835 predicted 1118
11 SASI_Mm01_00101827 predicted 1446
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009242
VALIDATED
SPARC MISSION shRNA Bacterial Glycerol Stock
secreted protein, acidic, cysteine-rich (osteonectin)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009242.1-908s1c1
Sequence:CCGGCCTAGACAACGACAAGTACATCTCGAGATGTACTTGTCGTTGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009242.1-413s1c1
Sequence:CCGGGAAGGTATGCAGCAATGACAACTCGAGTTGTCATTGCTGCATACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009242.1-521s1c1
Sequence:CCGGCATCGGACCATGCAAATACATCTCGAGATGTATTTGCATGGTCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009242.1-308s1c1
Sequence:CCGGCCATCATTGCAAACATGGCAACTCGAGTTGCCATGTTTGCAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009242.4-1529s21c1
Sequence:CCGGAGCACGAGGAGATATCTCTAGCTCGAGCTAGAGATATCTCCTCGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009242.4-1196s21c1
Sequence:CCGGACAAGGATCTGGTGATCTAAGCTCGAGCTTAGATCACCAGATCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009242.4-1346s21c1
Sequence:CCGGGAATACATTAACGGTGCTAAACTCGAGTTTAGCACCGTTAATGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009242.4-959s21c1
Sequence:CCGGACTTTGAGAAGAACTACAATACTCGAGTATTGTAGTTCTTCTCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009242
VALIDATED
SPARC MISSION shRNA shRNA Plasmid DNA
secreted protein, acidic, cysteine-rich (osteonectin)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009242.1-908s1c1
Sequence:CCGGCCTAGACAACGACAAGTACATCTCGAGATGTACTTGTCGTTGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009242.1-413s1c1
Sequence:CCGGGAAGGTATGCAGCAATGACAACTCGAGTTGTCATTGCTGCATACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009242.1-521s1c1
Sequence:CCGGCATCGGACCATGCAAATACATCTCGAGATGTATTTGCATGGTCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009242.1-308s1c1
Sequence:CCGGCCATCATTGCAAACATGGCAACTCGAGTTGCCATGTTTGCAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009242.4-1529s21c1
Sequence:CCGGAGCACGAGGAGATATCTCTAGCTCGAGCTAGAGATATCTCCTCGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009242.4-1196s21c1
Sequence:CCGGACAAGGATCTGGTGATCTAAGCTCGAGCTTAGATCACCAGATCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009242.4-1346s21c1
Sequence:CCGGGAATACATTAACGGTGCTAAACTCGAGTTTAGCACCGTTAATGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009242.4-959s21c1
Sequence:CCGGACTTTGAGAAGAACTACAATACTCGAGTATTGTAGTTCTTCTCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009242
VALIDATED
SPARC MISSION shRNA Lentiviral Transduction Particles
secreted protein, acidic, cysteine-rich (osteonectin)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009242.1-908s1c1
Sequence:CCGGCCTAGACAACGACAAGTACATCTCGAGATGTACTTGTCGTTGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009242.1-413s1c1
Sequence:CCGGGAAGGTATGCAGCAATGACAACTCGAGTTGTCATTGCTGCATACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009242.1-521s1c1
Sequence:CCGGCATCGGACCATGCAAATACATCTCGAGATGTATTTGCATGGTCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009242.1-308s1c1
Sequence:CCGGCCATCATTGCAAACATGGCAACTCGAGTTGCCATGTTTGCAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009242.4-1529s21c1
Sequence:CCGGAGCACGAGGAGATATCTCTAGCTCGAGCTAGAGATATCTCCTCGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009242.4-1196s21c1
Sequence:CCGGACAAGGATCTGGTGATCTAAGCTCGAGCTTAGATCACCAGATCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009242.4-1346s21c1
Sequence:CCGGGAATACATTAACGGTGCTAAACTCGAGTTTAGCACCGTTAATGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009242.4-959s21c1
Sequence:CCGGACTTTGAGAAGAACTACAATACTCGAGTATTGTAGTTCTTCTCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003118
VALIDATED
SPARC MISSION shRNA Bacterial Glycerol Stock
secreted protein, acidic, cysteine-rich (osteonectin)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_003118.1-201s1c1
Sequence:CCGGCCAGGTGGAAGTAGGAGAATTCTCGAGAATTCTCCTACTTCCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_003118.1-643s1c1
Sequence:CCGGGTGAAGAAGATCCATGAGAATCTCGAGATTCTCATGGATCTTCTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003118.1-1845s1c1
Sequence:CCGGCGGTTGTTCTTTCCTCACATTCTCGAGAATGTGAGGAAAGAACAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003118.1-879s1c1
Sequence:CCGGCCTGGACAATGACAAGTACATCTCGAGATGTACTTGTCATTGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_003118.1-423s1c1
Sequence:CCGGCTGCCACTTCTTTGCCACAAACTCGAGTTTGTGGCAAAGAAGTGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003118
VALIDATED
SPARC MISSION shRNA shRNA Plasmid DNA
secreted protein, acidic, cysteine-rich (osteonectin)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_003118.1-201s1c1
Sequence:CCGGCCAGGTGGAAGTAGGAGAATTCTCGAGAATTCTCCTACTTCCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_003118.1-643s1c1
Sequence:CCGGGTGAAGAAGATCCATGAGAATCTCGAGATTCTCATGGATCTTCTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003118.1-1845s1c1
Sequence:CCGGCGGTTGTTCTTTCCTCACATTCTCGAGAATGTGAGGAAAGAACAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003118.1-879s1c1
Sequence:CCGGCCTGGACAATGACAAGTACATCTCGAGATGTACTTGTCATTGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_003118.1-423s1c1
Sequence:CCGGCTGCCACTTCTTTGCCACAAACTCGAGTTTGTGGCAAAGAAGTGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003118
VALIDATED
SPARC MISSION shRNA Lentiviral Transduction Particles
secreted protein, acidic, cysteine-rich (osteonectin)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_003118.1-201s1c1
Sequence:CCGGCCAGGTGGAAGTAGGAGAATTCTCGAGAATTCTCCTACTTCCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_003118.1-643s1c1
Sequence:CCGGGTGAAGAAGATCCATGAGAATCTCGAGATTCTCATGGATCTTCTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003118.1-1845s1c1
Sequence:CCGGCGGTTGTTCTTTCCTCACATTCTCGAGAATGTGAGGAAAGAACAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003118.1-879s1c1
Sequence:CCGGCCTGGACAATGACAAGTACATCTCGAGATGTACTTGTCATTGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_003118.1-423s1c1
Sequence:CCGGCTGCCACTTCTTTGCCACAAACTCGAGTTTGTGGCAAAGAAGTGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks