EMAIL THIS PAGE TO A FRIEND

SPARCL1

SPARC-like 1 (hevin)

Synonyms: PIG33 SC1
UniProtKB ID: Q14515, Q14800
Gene ID:
Mouse(13602) SPARC-like 1
Rat(25434) SPARC-like 1 (hevin)
cow(507537) SPARC-like 1 (hevin)
sheep(101123041) SPARC-like 1 (hevin)
naked mole-rat(101724078) SPARC-like 1 (hevin)
Domestic Rabbit(100347422) SPARC-like 1 (hevin)
domestic guinea pig(100734715) SPARC-like 1 (hevin)
Zebrafish(567331) SPARC-like 1
chicken(422586) SPARC-like 1 (hevin)
domestic cat(101096060) SPARC-like 1 (hevin)
Horse(100052928) SPARC-like 1 (hevin)
dog(478470) SPARC-like 1 (hevin)
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1716 Human SPARCL1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010097 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010097 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010097 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004684 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004684 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004684 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU014651 MISSION® esiRNA esiRNA targeting mouse Sparcl1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128310 Rosetta Predictions human pricing
NM_004684 Rosetta Predictions human pricing
NM_012946 Rosetta Predictions rat pricing
NM_010097 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331076 predicted 1941
2 SASI_Hs02_00331077 predicted 615
3 SASI_Hs02_00331078 predicted 2298
4 SASI_Hs02_00331079 predicted 2114
5 SASI_Hs02_00331080 predicted 1895
6 SASI_Hs02_00331081 predicted 1300
7 SASI_Hs02_00331082 predicted 2002
8 SASI_Hs02_00331083 predicted 623
9 SASI_Hs02_00331084 predicted 2086
10 SASI_Hs02_00331085 predicted 2128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245950 predicted 1689
2 SASI_Hs01_00245951 predicted 745
3 SASI_Hs01_00245952 predicted 365
4 SASI_Hs02_00338117 predicted 834
5 SASI_Hs01_00245953 predicted 2040
6 SASI_Hs02_00338118 predicted 1864
7 SASI_Hs01_00245954 predicted 1948
8 SASI_Hs01_00245955 predicted 619
9 SASI_Hs01_00245956 predicted 945
10 SASI_Hs01_00245957 predicted 1051
11 SASI_Hs01_00245958 predicted 1751
12 SASI_Hs01_00245959 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012946 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096169 predicted 401
2 SASI_Rn02_00260516 predicted 1811
3 SASI_Rn01_00096170 predicted 1380
4 SASI_Rn01_00096171 predicted 1055
5 SASI_Rn01_00096173 predicted 722
6 SASI_Rn01_00096174 predicted 1361
7 SASI_Rn01_00096175 predicted 2129
8 SASI_Rn01_00096176 predicted 1537
9 SASI_Rn01_00096177 predicted 1609
10 SASI_Rn01_00096178 predicted 2174
11 SASI_Rn01_00096172 predicted 2076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010097 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135946 predicted 2213
2 SASI_Mm02_00317799 predicted 2381
3 SASI_Mm01_00135947 predicted 1461
4 SASI_Mm01_00135948 predicted 2411
5 SASI_Mm01_00135949 predicted 712
6 SASI_Mm01_00135950 predicted 443
7 SASI_Mm01_00135952 predicted 2295
8 SASI_Mm01_00135953 predicted 1973
9 SASI_Mm01_00135954 predicted 2161
10 SASI_Mm01_00135955 predicted 604
11 SASI_Mm01_00135951 predicted 1281
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010097
VALIDATED
SPARCL1 MISSION shRNA Bacterial Glycerol Stock
SPARC-like 1 (hevin)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010097.4-2947s21c1
Sequence:CCGGCTCTGTGCATCTGCGTTTATACTCGAGTATAAACGCAGATGCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010097.4-2623s21c1
Sequence:CCGGGGCCACTGCTTTGGAATTAAACTCGAGTTTAATTCCAAAGCAGTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010097.2-2412s1c1
Sequence:CCGGCCATGACACTATACATTCATACTCGAGTATGAATGTATAGTGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010097.2-820s1c1
Sequence:CCGGCCAACGCGCAAACATCACAAACTCGAGTTTGTGATGTTTGCGCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010097.2-2059s1c1
Sequence:CCGGCCATCCCATTGAACTTCTCTTCTCGAGAAGAGAAGTTCAATGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010097.2-1872s1c1
Sequence:CCGGGCAAATCTATTCCTGCTTGTACTCGAGTACAAGCAGGAATAGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010097.2-1480s1c1
Sequence:CCGGCCTCTCCTATTACCTCAAATACTCGAGTATTTGAGGTAATAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010097
VALIDATED
SPARCL1 MISSION shRNA shRNA Plasmid DNA
SPARC-like 1 (hevin)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010097.4-2947s21c1
Sequence:CCGGCTCTGTGCATCTGCGTTTATACTCGAGTATAAACGCAGATGCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010097.4-2623s21c1
Sequence:CCGGGGCCACTGCTTTGGAATTAAACTCGAGTTTAATTCCAAAGCAGTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010097.2-2412s1c1
Sequence:CCGGCCATGACACTATACATTCATACTCGAGTATGAATGTATAGTGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010097.2-820s1c1
Sequence:CCGGCCAACGCGCAAACATCACAAACTCGAGTTTGTGATGTTTGCGCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010097.2-2059s1c1
Sequence:CCGGCCATCCCATTGAACTTCTCTTCTCGAGAAGAGAAGTTCAATGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010097.2-1872s1c1
Sequence:CCGGGCAAATCTATTCCTGCTTGTACTCGAGTACAAGCAGGAATAGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010097.2-1480s1c1
Sequence:CCGGCCTCTCCTATTACCTCAAATACTCGAGTATTTGAGGTAATAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010097
VALIDATED
SPARCL1 MISSION shRNA Lentiviral Transduction Particles
SPARC-like 1 (hevin)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010097.4-2947s21c1
Sequence:CCGGCTCTGTGCATCTGCGTTTATACTCGAGTATAAACGCAGATGCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010097.4-2623s21c1
Sequence:CCGGGGCCACTGCTTTGGAATTAAACTCGAGTTTAATTCCAAAGCAGTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010097.2-2412s1c1
Sequence:CCGGCCATGACACTATACATTCATACTCGAGTATGAATGTATAGTGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010097.2-820s1c1
Sequence:CCGGCCAACGCGCAAACATCACAAACTCGAGTTTGTGATGTTTGCGCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010097.2-2059s1c1
Sequence:CCGGCCATCCCATTGAACTTCTCTTCTCGAGAAGAGAAGTTCAATGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010097.2-1872s1c1
Sequence:CCGGGCAAATCTATTCCTGCTTGTACTCGAGTACAAGCAGGAATAGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010097.2-1480s1c1
Sequence:CCGGCCTCTCCTATTACCTCAAATACTCGAGTATTTGAGGTAATAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004684
SPARCL1 MISSION shRNA Bacterial Glycerol Stock
SPARC-like 1 (hevin)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004684.4-1180s21c1
Sequence:CCGGATACCCAATCTGATGATATTTCTCGAGAAATATCATCAGATTGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004684.4-2610s21c1
Sequence:CCGGCAACCTATGCACCAGGTATTTCTCGAGAAATACCTGGTGCATAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004684.4-2099s21c1
Sequence:CCGGTGAACACGCTGGTTATCTAAACTCGAGTTTAGATAACCAGCGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004684.2-960s1c1
Sequence:CCGGCCCACAATGATAACCAAGAAACTCGAGTTTCTTGGTTATCATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004684.2-1978s1c1
Sequence:CCGGGCAGAGAAATAAAGTCAAGAACTCGAGTTCTTGACTTTATTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004684.2-373s1c1
Sequence:CCGGCCCGACAAATGCAAGATTATTCTCGAGAATAATCTTGCATTTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004684.2-1848s1c1
Sequence:CCGGGCAAATCTATTCCTACTTGTACTCGAGTACAAGTAGGAATAGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004684.2-1767s1c1
Sequence:CCGGCCTGTCATCTATTCGCTACTACTCGAGTAGTAGCGAATAGATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004684
SPARCL1 MISSION shRNA shRNA Plasmid DNA
SPARC-like 1 (hevin)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004684.4-1180s21c1
Sequence:CCGGATACCCAATCTGATGATATTTCTCGAGAAATATCATCAGATTGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004684.4-2610s21c1
Sequence:CCGGCAACCTATGCACCAGGTATTTCTCGAGAAATACCTGGTGCATAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004684.4-2099s21c1
Sequence:CCGGTGAACACGCTGGTTATCTAAACTCGAGTTTAGATAACCAGCGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004684.2-960s1c1
Sequence:CCGGCCCACAATGATAACCAAGAAACTCGAGTTTCTTGGTTATCATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004684.2-1978s1c1
Sequence:CCGGGCAGAGAAATAAAGTCAAGAACTCGAGTTCTTGACTTTATTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004684.2-373s1c1
Sequence:CCGGCCCGACAAATGCAAGATTATTCTCGAGAATAATCTTGCATTTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004684.2-1848s1c1
Sequence:CCGGGCAAATCTATTCCTACTTGTACTCGAGTACAAGTAGGAATAGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004684.2-1767s1c1
Sequence:CCGGCCTGTCATCTATTCGCTACTACTCGAGTAGTAGCGAATAGATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004684
SPARCL1 MISSION shRNA Lentiviral Transduction Particles
SPARC-like 1 (hevin)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004684.4-1180s21c1
Sequence:CCGGATACCCAATCTGATGATATTTCTCGAGAAATATCATCAGATTGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004684.4-2610s21c1
Sequence:CCGGCAACCTATGCACCAGGTATTTCTCGAGAAATACCTGGTGCATAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004684.4-2099s21c1
Sequence:CCGGTGAACACGCTGGTTATCTAAACTCGAGTTTAGATAACCAGCGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004684.2-960s1c1
Sequence:CCGGCCCACAATGATAACCAAGAAACTCGAGTTTCTTGGTTATCATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004684.2-1978s1c1
Sequence:CCGGGCAGAGAAATAAAGTCAAGAACTCGAGTTCTTGACTTTATTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004684.2-373s1c1
Sequence:CCGGCCCGACAAATGCAAGATTATTCTCGAGAATAATCTTGCATTTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004684.2-1848s1c1
Sequence:CCGGGCAAATCTATTCCTACTTGTACTCGAGTACAAGTAGGAATAGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004684.2-1767s1c1
Sequence:CCGGCCTGTCATCTATTCGCTACTACTCGAGTAGTAGCGAATAGATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks