EMAIL THIS PAGE TO A FRIEND

SPAST

spastin

Synonyms: ADPSP FSP2 SPG4
UniProtKB ID: Q9UBP0, A7E2A7, Q9UPR9
Gene ID:
Human(6683) Summary: This gene encodes a member of the AAA (ATPases associated with a variety of cellular activities) protein family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organelle biogenesis, protein folding, and proteolysis. The encoded ATPase may be involved in the assembly or function of nuclear protein complexes. Two transcript variants encoding distinct isoforms have been identified for this gene. Other alternative splice variants have been described but their full length sequences have not been determined. Mutations associated with this gene cause the most frequent form of autosomal dominant spastic paraplegia 4. [provided by RefSeq, Jul 2008]
Mouse(50850) spastin
Rat(362700) spastin
chicken(421481) spastin
dog(608582) spastin
cow(521442) spastin
175 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016962 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016962 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016962 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014946 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014946 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014946 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014946 Rosetta Predictions human pricing
NM_199436 Rosetta Predictions human pricing
NM_001108702 Rosetta Predictions rat pricing
NM_016962 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087341 predicted 2149
2 SASI_Hs01_00087342 predicted 1380
3 SASI_Hs01_00087343 predicted 1275
4 SASI_Hs01_00087344 predicted 1393
5 SASI_Hs02_00346620 predicted 1650
6 SASI_Hs01_00087345 predicted 1511
7 SASI_Hs01_00087346 predicted 1851
8 SASI_Hs01_00087347 predicted 2013
9 SASI_Hs01_00087348 predicted 1310
10 SASI_Hs01_00087349 predicted 1415
11 SASI_Hs01_00087340 predicted 1217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016356 predicted 2060
2 SASI_Hs01_00016357 predicted 1285
3 SASI_Hs01_00016358 predicted 1179
4 SASI_Hs01_00016359 predicted 1292
5 SASI_Hs02_00372830 predicted 1557
6 SASI_Hs01_00016360 predicted 1419
7 SASI_Hs01_00016361 predicted 1753
8 SASI_Hs01_00016362 predicted 1911
9 SASI_Hs01_00016363 predicted 1220
10 SASI_Hs01_00016364 predicted 1314
11 SASI_Hs01_00016355 predicted 1122
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108702 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241235 predicted 828
2 SASI_Rn02_00241236 predicted 1114
3 SASI_Rn02_00241237 predicted 815
4 SASI_Rn02_00241238 predicted 781
5 SASI_Rn02_00241239 predicted 1422
6 SASI_Rn02_00241240 predicted 1490
7 SASI_Rn02_00241241 predicted 792
8 SASI_Rn02_00241242 predicted 1325
9 SASI_Rn02_00241243 predicted 1255
10 SASI_Rn02_00241244 predicted 1342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016962 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145016 predicted 1831
2 SASI_Mm01_00145017 predicted 944
3 SASI_Mm02_00323813 predicted 898
4 SASI_Mm01_00145019 predicted 699
5 SASI_Mm01_00145020 predicted 1478
6 SASI_Mm01_00145021 predicted 1253
7 SASI_Mm01_00145022 predicted 521
8 SASI_Mm01_00145023 predicted 1674
9 SASI_Mm01_00145024 predicted 606
10 SASI_Mm01_00145025 predicted 1313
11 SASI_Mm01_00145018 predicted 674
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016962
VALIDATED
SPAST MISSION shRNA Bacterial Glycerol Stock
spastin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016962.1-1536s1c1
Sequence:CCGGCGTTTCATTAAACGGGTATATCTCGAGATATACCCGTTTAATGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016962.1-753s1c1
Sequence:CCGGCCCTTAACACATGCTAGTAATCTCGAGATTACTAGCATGTGTTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016962.1-1332s1c1
Sequence:CCGGCGAGAACTTCAACCATCTATACTCGAGTATAGATGGTTGAAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016962.1-522s1c1
Sequence:CCGGGCTGTTATAGTTACGGGCCAACTCGAGTTGGCCCGTAACTATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016962.1-1913s21c1
Sequence:CCGGGCCCATAGAACATCGCACTTCCTCGAGGAAGTGCGATGTTCTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016962.1-1332s21c1
Sequence:CCGGCGAGAACTTCAACCATCTATACTCGAGTATAGATGGTTGAAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016962.1-1007s21c1
Sequence:CCGGCAATCTTGCTAACCTTATAATCTCGAGATTATAAGGTTAGCAAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016962.1-1536s21c1
Sequence:CCGGCGTTTCATTAAACGGGTATATCTCGAGATATACCCGTTTAATGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016962.1-753s21c1
Sequence:CCGGCCCTTAACACATGCTAGTAATCTCGAGATTACTAGCATGTGTTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016962
VALIDATED
SPAST MISSION shRNA shRNA Plasmid DNA
spastin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016962.1-1536s1c1
Sequence:CCGGCGTTTCATTAAACGGGTATATCTCGAGATATACCCGTTTAATGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016962.1-753s1c1
Sequence:CCGGCCCTTAACACATGCTAGTAATCTCGAGATTACTAGCATGTGTTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016962.1-1332s1c1
Sequence:CCGGCGAGAACTTCAACCATCTATACTCGAGTATAGATGGTTGAAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016962.1-522s1c1
Sequence:CCGGGCTGTTATAGTTACGGGCCAACTCGAGTTGGCCCGTAACTATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016962.1-1913s21c1
Sequence:CCGGGCCCATAGAACATCGCACTTCCTCGAGGAAGTGCGATGTTCTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016962.1-1332s21c1
Sequence:CCGGCGAGAACTTCAACCATCTATACTCGAGTATAGATGGTTGAAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016962.1-1007s21c1
Sequence:CCGGCAATCTTGCTAACCTTATAATCTCGAGATTATAAGGTTAGCAAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016962.1-1536s21c1
Sequence:CCGGCGTTTCATTAAACGGGTATATCTCGAGATATACCCGTTTAATGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016962.1-753s21c1
Sequence:CCGGCCCTTAACACATGCTAGTAATCTCGAGATTACTAGCATGTGTTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016962
VALIDATED
SPAST MISSION shRNA Lentiviral Transduction Particles
spastin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016962.1-1536s1c1
Sequence:CCGGCGTTTCATTAAACGGGTATATCTCGAGATATACCCGTTTAATGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016962.1-753s1c1
Sequence:CCGGCCCTTAACACATGCTAGTAATCTCGAGATTACTAGCATGTGTTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016962.1-1332s1c1
Sequence:CCGGCGAGAACTTCAACCATCTATACTCGAGTATAGATGGTTGAAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016962.1-522s1c1
Sequence:CCGGGCTGTTATAGTTACGGGCCAACTCGAGTTGGCCCGTAACTATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016962.1-1913s21c1
Sequence:CCGGGCCCATAGAACATCGCACTTCCTCGAGGAAGTGCGATGTTCTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016962.1-1332s21c1
Sequence:CCGGCGAGAACTTCAACCATCTATACTCGAGTATAGATGGTTGAAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016962.1-1007s21c1
Sequence:CCGGCAATCTTGCTAACCTTATAATCTCGAGATTATAAGGTTAGCAAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016962.1-1536s21c1
Sequence:CCGGCGTTTCATTAAACGGGTATATCTCGAGATATACCCGTTTAATGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016962.1-753s21c1
Sequence:CCGGCCCTTAACACATGCTAGTAATCTCGAGATTACTAGCATGTGTTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014946
SPAST MISSION shRNA Bacterial Glycerol Stock
spastin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014946.3-3344s1c1
Sequence:CCGGGCCCTTAGTTTACTGGTTAAACTCGAGTTTAACCAGTAAACTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014946.3-1512s1c1
Sequence:CCGGCGAGAACTTCAACCTTCTATACTCGAGTATAGAAGGTTGAAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014946.3-1715s1c1
Sequence:CCGGGCGTTTCATCAAACGGGTATACTCGAGTATACCCGTTTGATGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014946.3-2012s1c1
Sequence:CCGGCCCTCAAACTTTAGAAGCGTACTCGAGTACGCTTCTAAAGTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014946.3-1586s1c1
Sequence:CCGGCGATGCTAGTAGACGCCTAAACTCGAGTTTAGGCGTCTACTAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014946.3-838s21c1
Sequence:CCGGAGTCACAAACGGACGTCTATACTCGAGTATAGACGTCCGTTTGTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014946.3-1949s21c1
Sequence:CCGGGATGAGAAATATTCGATTATCCTCGAGGATAATCGAATATTTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014946.3-1664s21c1
Sequence:CCGGTGTAATGGGTGCAACTAATAGCTCGAGCTATTAGTTGCACCCATTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014946
SPAST MISSION shRNA shRNA Plasmid DNA
spastin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014946.3-3344s1c1
Sequence:CCGGGCCCTTAGTTTACTGGTTAAACTCGAGTTTAACCAGTAAACTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014946.3-1512s1c1
Sequence:CCGGCGAGAACTTCAACCTTCTATACTCGAGTATAGAAGGTTGAAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014946.3-1715s1c1
Sequence:CCGGGCGTTTCATCAAACGGGTATACTCGAGTATACCCGTTTGATGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014946.3-2012s1c1
Sequence:CCGGCCCTCAAACTTTAGAAGCGTACTCGAGTACGCTTCTAAAGTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014946.3-1586s1c1
Sequence:CCGGCGATGCTAGTAGACGCCTAAACTCGAGTTTAGGCGTCTACTAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014946.3-838s21c1
Sequence:CCGGAGTCACAAACGGACGTCTATACTCGAGTATAGACGTCCGTTTGTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014946.3-1949s21c1
Sequence:CCGGGATGAGAAATATTCGATTATCCTCGAGGATAATCGAATATTTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014946.3-1664s21c1
Sequence:CCGGTGTAATGGGTGCAACTAATAGCTCGAGCTATTAGTTGCACCCATTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014946
SPAST MISSION shRNA Lentiviral Transduction Particles
spastin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014946.3-3344s1c1
Sequence:CCGGGCCCTTAGTTTACTGGTTAAACTCGAGTTTAACCAGTAAACTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014946.3-1512s1c1
Sequence:CCGGCGAGAACTTCAACCTTCTATACTCGAGTATAGAAGGTTGAAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014946.3-1715s1c1
Sequence:CCGGGCGTTTCATCAAACGGGTATACTCGAGTATACCCGTTTGATGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014946.3-2012s1c1
Sequence:CCGGCCCTCAAACTTTAGAAGCGTACTCGAGTACGCTTCTAAAGTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014946.3-1586s1c1
Sequence:CCGGCGATGCTAGTAGACGCCTAAACTCGAGTTTAGGCGTCTACTAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014946.3-838s21c1
Sequence:CCGGAGTCACAAACGGACGTCTATACTCGAGTATAGACGTCCGTTTGTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014946.3-1949s21c1
Sequence:CCGGGATGAGAAATATTCGATTATCCTCGAGGATAATCGAATATTTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014946.3-1664s21c1
Sequence:CCGGTGTAATGGGTGCAACTAATAGCTCGAGCTATTAGTTGCACCCATTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks