EMAIL THIS PAGE TO A FRIEND

SPATA13

spermatogenesis associated 13

Synonyms: ARHGEF29 ASEF2
Gene ID:
Mouse(219140) spermatogenesis associated 13
Rat(305938) spermatogenesis associated 13
Zebrafish(568426) spermatogenesis associated 13
chicken(418940) spermatogenesis associated 13
domestic cat(101095787) spermatogenesis associated 13
dog(486040) spermatogenesis associated 13
domestic guinea pig(100728737) spermatogenesis associated 13
Domestic Rabbit(100354861) spermatogenesis associated 13
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033272 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033272 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033272 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153023 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153023 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153023 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153023 Rosetta Predictions human pricing
XM_001065113 Rosetta Predictions rat pricing
XM_224253 Rosetta Predictions rat pricing
XM_901902 Rosetta Predictions mouse pricing
XM_923227 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153023 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366978 predicted 1261
2 SASI_Hs01_00135233 predicted 1343
3 SASI_Hs01_00135234 predicted 1017
4 SASI_Hs01_00135235 predicted 1740
5 SASI_Hs01_00135236 predicted 2137
6 SASI_Hs01_00135237 predicted 1623
7 SASI_Hs02_00366979 predicted 1634
8 SASI_Hs01_00135239 predicted 1325
9 SASI_Hs01_00135240 predicted 2388
10 SASI_Hs01_00135241 predicted 2410
11 SASI_Hs01_00135238 predicted 1614
12 SASI_Hs01_00135242 predicted 1625
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065113 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312912 predicted 1324
2 SASI_Rn02_00312913 predicted 1193
3 SASI_Rn02_00312914 predicted 1245
4 SASI_Rn02_00312915 predicted 728
5 SASI_Rn02_00312916 predicted 535
6 SASI_Rn02_00312917 predicted 1348
7 SASI_Rn02_00312918 predicted 1250
8 SASI_Rn02_00312919 predicted 1039
9 SASI_Rn02_00312920 predicted 1491
10 SASI_Rn02_00312921 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224253 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381849 predicted 1497
2 SASI_Rn02_00381850 predicted 1668
3 SASI_Rn02_00381851 predicted 1425
4 SASI_Rn02_00381852 predicted 1497
5 SASI_Rn02_00381853 predicted 269
6 SASI_Rn02_00381854 predicted 374
7 SASI_Rn02_00381855 predicted 1945
8 SASI_Rn02_00381856 predicted 2213
9 SASI_Rn02_00381857 predicted 2223
10 SASI_Rn02_00381858 predicted 2447
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901902 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233354 predicted 3189
2 SASI_Mm01_00233355 predicted 1594
3 SASI_Mm02_00430211 predicted 2974
4 SASI_Mm02_00430212 predicted 2664
5 SASI_Mm01_00233356 predicted 4386
6 SASI_Mm01_00233357 predicted 3433
7 SASI_Mm01_00233358 predicted 2697
8 SASI_Mm01_00233359 predicted 2737
9 SASI_Mm01_00233360 predicted 2092
10 SASI_Mm01_00233361 predicted 2899
11 SASI_Mm01_00233352 predicted 2665
12 SASI_Mm01_00233353 predicted 3274
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_923227 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00443701 predicted 3186
2 SASI_Mm02_00443702 predicted 1589
3 SASI_Mm02_00443703 predicted 2979
4 SASI_Mm02_00443704 predicted 2664
5 SASI_Mm02_00443705 predicted 4387
6 SASI_Mm02_00443706 predicted 3434
7 SASI_Mm02_00443707 predicted 2698
8 SASI_Mm02_00443708 predicted 2731
9 SASI_Mm02_00443709 predicted 2089
10 SASI_Mm02_00443710 predicted 2899
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033272
VALIDATED
SPATA13 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 13
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000363971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033272.1-2889s21c1
Sequence:CCGGTTGCGCAGCTAGCCACTATTTCTCGAGAAATAGTGGCTAGCTGCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033272.1-2368s21c1
Sequence:CCGGTTCGGCCTTAGTGGATGATAACTCGAGTTATCATCCACTAAGGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033272.1-2799s21c1
Sequence:CCGGTGAACACCGAGCGAGTGTATACTCGAGTATACACTCGCTCGGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033272
VALIDATED
SPATA13 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 13
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000363971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033272.1-2889s21c1
Sequence:CCGGTTGCGCAGCTAGCCACTATTTCTCGAGAAATAGTGGCTAGCTGCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033272.1-2368s21c1
Sequence:CCGGTTCGGCCTTAGTGGATGATAACTCGAGTTATCATCCACTAAGGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033272.1-2799s21c1
Sequence:CCGGTGAACACCGAGCGAGTGTATACTCGAGTATACACTCGCTCGGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033272
VALIDATED
SPATA13 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 13
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000363971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033272.1-2889s21c1
Sequence:CCGGTTGCGCAGCTAGCCACTATTTCTCGAGAAATAGTGGCTAGCTGCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033272.1-2368s21c1
Sequence:CCGGTTCGGCCTTAGTGGATGATAACTCGAGTTATCATCCACTAAGGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033272.1-2799s21c1
Sequence:CCGGTGAACACCGAGCGAGTGTATACTCGAGTATACACTCGCTCGGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153023
SPATA13 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 13
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000188181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153023.1-1097s1c1
Sequence:CCGGCCACAGACACTGTGAGAACAACTCGAGTTGTTCTCACAGTGTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153023.1-1608s1c1
Sequence:CCGGCACGGTGATTACAGCAACATACTCGAGTATGTTGCTGTAATCACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153023.1-1610s1c1
Sequence:CCGGCGGTGATTACAGCAACATAAACTCGAGTTTATGTTGCTGTAATCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186516    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153023.1-2851s1c1
Sequence:CCGGGCTCTTACTCTCTTCTGTAATCTCGAGATTACAGAAGAGAGTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153023.1-687s1c1
Sequence:CCGGGCATCCAACGTTTCTTCAGATCTCGAGATCTGAAGAAACGTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153023
SPATA13 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 13
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000188181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153023.1-1097s1c1
Sequence:CCGGCCACAGACACTGTGAGAACAACTCGAGTTGTTCTCACAGTGTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153023.1-1608s1c1
Sequence:CCGGCACGGTGATTACAGCAACATACTCGAGTATGTTGCTGTAATCACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153023.1-1610s1c1
Sequence:CCGGCGGTGATTACAGCAACATAAACTCGAGTTTATGTTGCTGTAATCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186516    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153023.1-2851s1c1
Sequence:CCGGGCTCTTACTCTCTTCTGTAATCTCGAGATTACAGAAGAGAGTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153023.1-687s1c1
Sequence:CCGGGCATCCAACGTTTCTTCAGATCTCGAGATCTGAAGAAACGTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153023
SPATA13 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 13
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000188181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153023.1-1097s1c1
Sequence:CCGGCCACAGACACTGTGAGAACAACTCGAGTTGTTCTCACAGTGTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153023.1-1608s1c1
Sequence:CCGGCACGGTGATTACAGCAACATACTCGAGTATGTTGCTGTAATCACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153023.1-1610s1c1
Sequence:CCGGCGGTGATTACAGCAACATAAACTCGAGTTTATGTTGCTGTAATCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186516    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153023.1-2851s1c1
Sequence:CCGGGCTCTTACTCTCTTCTGTAATCTCGAGATTACAGAAGAGAGTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153023.1-687s1c1
Sequence:CCGGGCATCCAACGTTTCTTCAGATCTCGAGATCTGAAGAAACGTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks