EMAIL THIS PAGE TO A FRIEND

SPATA16

spermatogenesis associated 16

Synonyms: NYD-SP12 SPGF6
Gene ID:
Human(83893) Summary: This gene encodes a testis-specific protein that belongs to the tetratricopeptide repeat-like superfamily. The encoded protein localizes to the Golgi apparatus and may play a role in spermatogenesis. [provided by RefSeq, May 2010]
Mouse(70862) spermatogenesis associated 16
Rat(294932) spermatogenesis associated 16
chicken(429157) spermatogenesis associated 16
domestic cat(101082087) spermatogenesis associated 16
dog(478689) spermatogenesis associated 16
cow(538046) spermatogenesis associated 16
sheep(101112876) spermatogenesis associated 16
cow(617869) spermatogenesis associated 16
naked mole-rat(101704370) spermatogenesis associated 16
domestic guinea pig(100718101) spermatogenesis associated 16
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027583 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027583 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027583 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031955 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031955 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031955 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051191 MISSION® esiRNA esiRNA human SPATA16 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031955 Rosetta Predictions human pricing
XM_001063250 Rosetta Predictions rat pricing
XM_226993 Rosetta Predictions rat pricing
NM_027583 Rosetta Predictions mouse pricing
NM_029150 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205656 predicted 1087
2 SASI_Hs01_00205657 predicted 1179
3 SASI_Hs02_00359129 predicted 750
4 SASI_Hs02_00359130 predicted 1054
5 SASI_Hs01_00205658 predicted 493
6 SASI_Hs01_00205659 predicted 904
7 SASI_Hs01_00205660 predicted 419
8 SASI_Hs01_00205661 predicted 817
9 SASI_Hs01_00205662 predicted 338
10 SASI_Hs01_00205664 predicted 921
11 SASI_Hs01_00205655 predicted 937
12 SASI_Hs01_00205663 predicted 609
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063250 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306402 predicted 526
2 SASI_Rn02_00306403 predicted 1326
3 SASI_Rn02_00306404 predicted 583
4 SASI_Rn02_00306405 predicted 1749
5 SASI_Rn02_00306406 predicted 839
6 SASI_Rn02_00306407 predicted 1001
7 SASI_Rn02_00306408 predicted 796
8 SASI_Rn02_00306409 predicted 1475
9 SASI_Rn02_00306410 predicted 1385
10 SASI_Rn02_00306411 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226993 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384021 predicted 521
2 SASI_Rn02_00384022 predicted 1328
3 SASI_Rn02_00384023 predicted 590
4 SASI_Rn02_00384024 predicted 1752
5 SASI_Rn02_00384025 predicted 834
6 SASI_Rn02_00384026 predicted 993
7 SASI_Rn02_00384027 predicted 800
8 SASI_Rn02_00384028 predicted 1472
9 SASI_Rn02_00384029 predicted 1386
10 SASI_Rn02_00384030 predicted 1093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027583 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116707 predicted 377
2 SASI_Mm01_00116708 predicted 747
3 SASI_Mm01_00116709 predicted 382
4 SASI_Mm01_00116710 predicted 792
5 SASI_Mm01_00116711 predicted 952
6 SASI_Mm01_00116712 predicted 599
7 SASI_Mm01_00116713 predicted 1015
8 SASI_Mm01_00116714 predicted 786
9 SASI_Mm01_00116715 predicted 672
10 SASI_Mm01_00116716 predicted 1060
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029150 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071393 predicted 414
2 SASI_Mm01_00071394 predicted 782
3 SASI_Mm01_00071395 predicted 422
4 SASI_Mm01_00071396 predicted 830
5 SASI_Mm01_00071397 predicted 987
6 SASI_Mm01_00071398 predicted 633
7 SASI_Mm01_00071399 predicted 1050
8 SASI_Mm01_00071400 predicted 817
9 SASI_Mm01_00071401 predicted 712
10 SASI_Mm01_00071402 predicted 1101
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027583
SPATA16 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 16
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027583.1-989s1c1
Sequence:CCGGGCACTCTGTAAGCAAGCTCATCTCGAGATGAGCTTGCTTACAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027583.1-867s1c1
Sequence:CCGGCCAGCCTATTTCCGAAACCATCTCGAGATGGTTTCGGAAATAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027583.1-378s1c1
Sequence:CCGGGAGGCCAAGATAATGGAACTACTCGAGTAGTTCCATTATCTTGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027583.1-1229s1c1
Sequence:CCGGCCAGCAATATCTGCTGACACTCTCGAGAGTGTCAGCAGATATTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027583.1-770s1c1
Sequence:CCGGCGCAAGTTTCATTGAGACAAACTCGAGTTTGTCTCAATGAAACTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027583.2-1591s21c1
Sequence:CCGGGAATTGCTGCAGTCGCTAATGCTCGAGCATTAGCGACTGCAGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027583.2-1050s21c1
Sequence:CCGGGGCCGAAGCTTTCTCGGTTATCTCGAGATAACCGAGAAAGCTTCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027583.2-1544s21c1
Sequence:CCGGAGCTGGCAACAGTCCCTTATCCTCGAGGATAAGGGACTGTTGCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027583
SPATA16 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 16
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027583.1-989s1c1
Sequence:CCGGGCACTCTGTAAGCAAGCTCATCTCGAGATGAGCTTGCTTACAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027583.1-867s1c1
Sequence:CCGGCCAGCCTATTTCCGAAACCATCTCGAGATGGTTTCGGAAATAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027583.1-378s1c1
Sequence:CCGGGAGGCCAAGATAATGGAACTACTCGAGTAGTTCCATTATCTTGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027583.1-1229s1c1
Sequence:CCGGCCAGCAATATCTGCTGACACTCTCGAGAGTGTCAGCAGATATTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027583.1-770s1c1
Sequence:CCGGCGCAAGTTTCATTGAGACAAACTCGAGTTTGTCTCAATGAAACTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027583.2-1591s21c1
Sequence:CCGGGAATTGCTGCAGTCGCTAATGCTCGAGCATTAGCGACTGCAGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027583.2-1050s21c1
Sequence:CCGGGGCCGAAGCTTTCTCGGTTATCTCGAGATAACCGAGAAAGCTTCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027583.2-1544s21c1
Sequence:CCGGAGCTGGCAACAGTCCCTTATCCTCGAGGATAAGGGACTGTTGCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027583
SPATA16 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 16
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027583.1-989s1c1
Sequence:CCGGGCACTCTGTAAGCAAGCTCATCTCGAGATGAGCTTGCTTACAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027583.1-867s1c1
Sequence:CCGGCCAGCCTATTTCCGAAACCATCTCGAGATGGTTTCGGAAATAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027583.1-378s1c1
Sequence:CCGGGAGGCCAAGATAATGGAACTACTCGAGTAGTTCCATTATCTTGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027583.1-1229s1c1
Sequence:CCGGCCAGCAATATCTGCTGACACTCTCGAGAGTGTCAGCAGATATTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027583.1-770s1c1
Sequence:CCGGCGCAAGTTTCATTGAGACAAACTCGAGTTTGTCTCAATGAAACTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027583.2-1591s21c1
Sequence:CCGGGAATTGCTGCAGTCGCTAATGCTCGAGCATTAGCGACTGCAGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027583.2-1050s21c1
Sequence:CCGGGGCCGAAGCTTTCTCGGTTATCTCGAGATAACCGAGAAAGCTTCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027583.2-1544s21c1
Sequence:CCGGAGCTGGCAACAGTCCCTTATCCTCGAGGATAAGGGACTGTTGCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031955
SPATA16 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 16
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031955.2-1652s1c1
Sequence:CCGGGATGCTATGGACACCCTTGAACTCGAGTTCAAGGGTGTCCATAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031955.2-1089s1c1
Sequence:CCGGGAGCTGAATCTTTCTCGGTTACTCGAGTAACCGAGAAAGATTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031955.2-1193s1c1
Sequence:CCGGGCAGAGTATATGTACACAGATCTCGAGATCTGTGTACATATACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134934    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031955.2-1862s1c1
Sequence:CCGGCACTAAGATATCCCAGAAGAACTCGAGTTCTTCTGGGATATCTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031955.2-638s1c1
Sequence:CCGGCCTCAGATTGACAAATGGCTTCTCGAGAAGCCATTTGTCAATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031955.2-1386s1c1
Sequence:CCGGGAGAAGATACAGTGAGGCAAACTCGAGTTTGCCTCACTGTATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031955.4-1854s21c1
Sequence:CCGGGTTCAGCAAAGGTAGTCATTACTCGAGTAATGACTACCTTTGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031955.4-1060s21c1
Sequence:CCGGGCATAAGCAAGCTCATCAAACCTCGAGGTTTGATGAGCTTGCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031955.4-1576s21c1
Sequence:CCGGAGCAGTCCCAGGTGATTAATCCTCGAGGATTAATCACCTGGGACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031955
SPATA16 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 16
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031955.2-1652s1c1
Sequence:CCGGGATGCTATGGACACCCTTGAACTCGAGTTCAAGGGTGTCCATAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031955.2-1089s1c1
Sequence:CCGGGAGCTGAATCTTTCTCGGTTACTCGAGTAACCGAGAAAGATTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031955.2-1193s1c1
Sequence:CCGGGCAGAGTATATGTACACAGATCTCGAGATCTGTGTACATATACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134934    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031955.2-1862s1c1
Sequence:CCGGCACTAAGATATCCCAGAAGAACTCGAGTTCTTCTGGGATATCTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031955.2-638s1c1
Sequence:CCGGCCTCAGATTGACAAATGGCTTCTCGAGAAGCCATTTGTCAATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031955.2-1386s1c1
Sequence:CCGGGAGAAGATACAGTGAGGCAAACTCGAGTTTGCCTCACTGTATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031955.4-1854s21c1
Sequence:CCGGGTTCAGCAAAGGTAGTCATTACTCGAGTAATGACTACCTTTGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031955.4-1060s21c1
Sequence:CCGGGCATAAGCAAGCTCATCAAACCTCGAGGTTTGATGAGCTTGCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031955.4-1576s21c1
Sequence:CCGGAGCAGTCCCAGGTGATTAATCCTCGAGGATTAATCACCTGGGACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031955
SPATA16 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 16
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031955.2-1652s1c1
Sequence:CCGGGATGCTATGGACACCCTTGAACTCGAGTTCAAGGGTGTCCATAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031955.2-1089s1c1
Sequence:CCGGGAGCTGAATCTTTCTCGGTTACTCGAGTAACCGAGAAAGATTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031955.2-1193s1c1
Sequence:CCGGGCAGAGTATATGTACACAGATCTCGAGATCTGTGTACATATACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134934    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031955.2-1862s1c1
Sequence:CCGGCACTAAGATATCCCAGAAGAACTCGAGTTCTTCTGGGATATCTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031955.2-638s1c1
Sequence:CCGGCCTCAGATTGACAAATGGCTTCTCGAGAAGCCATTTGTCAATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031955.2-1386s1c1
Sequence:CCGGGAGAAGATACAGTGAGGCAAACTCGAGTTTGCCTCACTGTATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031955.4-1854s21c1
Sequence:CCGGGTTCAGCAAAGGTAGTCATTACTCGAGTAATGACTACCTTTGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031955.4-1060s21c1
Sequence:CCGGGCATAAGCAAGCTCATCAAACCTCGAGGTTTGATGAGCTTGCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031955.4-1576s21c1
Sequence:CCGGAGCAGTCCCAGGTGATTAATCCTCGAGGATTAATCACCTGGGACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks