EMAIL THIS PAGE TO A FRIEND

SPATA17

spermatogenesis associated 17

Synonyms: IQCH MSRG-11 MSRG11 RP11-144C20.1
UniProtKB ID: Q96L03, A5D6N2
Gene ID:
Mouse(74717) spermatogenesis associated 17
Rat(498305) spermatogenesis associated 17
domestic guinea pig(100718232) spermatogenesis associated 17
naked mole-rat(101706470) spermatogenesis associated 17
cow(618365) spermatogenesis associated 17
sheep(101121111) spermatogenesis associated 17
Zebrafish(799739) spermatogenesis associated 17
chicken(421354) spermatogenesis associated 17
Horse(100056847) spermatogenesis associated 17
domestic cat(101092910) spermatogenesis associated 17
dog(608327) spermatogenesis associated 17
146 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028848 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028848 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028848 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138796 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138796 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138796 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138796 Rosetta Predictions human pricing
XM_001066662 Rosetta Predictions rat pricing
XM_573534 Rosetta Predictions rat pricing
NM_028848 Rosetta Predictions mouse pricing
NM_029067 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138796 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093604 predicted 937
2 SASI_Hs01_00093605 predicted 722
3 SASI_Hs01_00093607 predicted 814
4 SASI_Hs01_00093608 predicted 817
5 SASI_Hs01_00093609 predicted 710
6 SASI_Hs01_00093610 predicted 758
7 SASI_Hs01_00093611 predicted 961
8 SASI_Hs02_00363949 predicted 953
9 SASI_Hs01_00093612 predicted 961
10 SASI_Hs01_00093613 predicted 783
11 SASI_Hs01_00093606 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066662 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318343 predicted 264
2 SASI_Rn02_00318344 predicted 263
3 SASI_Rn02_00318345 predicted 249
4 SASI_Rn02_00318346 predicted 230
5 SASI_Rn02_00318347 predicted 792
6 SASI_Rn02_00318348 predicted 784
7 SASI_Rn02_00318349 predicted 962
8 SASI_Rn02_00318350 predicted 895
9 SASI_Rn02_00318351 predicted 899
10 SASI_Rn02_00318352 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400464 predicted 262
2 SASI_Rn02_00400465 predicted 272
3 SASI_Rn02_00400466 predicted 273
4 SASI_Rn02_00400467 predicted 244
5 SASI_Rn02_00400468 predicted 244
6 SASI_Rn02_00400469 predicted 232
7 SASI_Rn02_00400470 predicted 245
8 SASI_Rn02_00400471 predicted 299
9 SASI_Rn02_00400472 predicted 299
10 SASI_Rn02_00400473 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028848 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334494 predicted 367
2 SASI_Mm02_00334495 predicted 236
3 SASI_Mm02_00334496 predicted 323
4 SASI_Mm01_00053681 predicted 439
5 SASI_Mm02_00334497 predicted 348
6 SASI_Mm02_00334498 predicted 370
7 SASI_Mm02_00334499 predicted 398
8 SASI_Mm02_00334500 predicted 436
9 SASI_Mm02_00334501 predicted 198
10 SASI_Mm01_00053686 predicted 249
11 SASI_Mm01_00053680 predicted 1142
12 SASI_Mm01_00053682 predicted 627
13 SASI_Mm01_00053683 predicted 869
14 SASI_Mm01_00053684 predicted 758
15 SASI_Mm01_00053685 predicted 216
16 SASI_Mm01_00053687 predicted 970
17 SASI_Mm01_00053688 predicted 728
18 SASI_Mm01_00053689 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029067 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334813 predicted 366
2 SASI_Mm02_00334814 predicted 233
3 SASI_Mm02_00334815 predicted 329
4 SASI_Mm02_00334816 predicted 436
5 SASI_Mm02_00334817 predicted 352
6 SASI_Mm02_00334818 predicted 369
7 SASI_Mm02_00334819 predicted 398
8 SASI_Mm02_00334820 predicted 436
9 SASI_Mm02_00334821 predicted 201
10 SASI_Mm02_00334822 predicted 249
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028848
SPATA17 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 17
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028848.3-959s21c1
Sequence:CCGGAGTCTTGGAACAGCGTTATAACTCGAGTTATAACGCTGTTCCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028848.3-611s21c1
Sequence:CCGGTTTGGAGGAGTTCGCAGAAATCTCGAGATTTCTGCGAACTCCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028848.3-721s21c1
Sequence:CCGGCAAAGCAGATTTCAGGTATATCTCGAGATATACCTGAAATCTGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028848.3-519s21c1
Sequence:CCGGGGCTTTAGGATCCGGAAATATCTCGAGATATTTCCGGATCCTAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028848.3-441s21c1
Sequence:CCGGGTTGTTGAGGCAGCATATTATCTCGAGATAATATGCTGCCTCAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028848
SPATA17 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 17
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028848.3-959s21c1
Sequence:CCGGAGTCTTGGAACAGCGTTATAACTCGAGTTATAACGCTGTTCCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028848.3-611s21c1
Sequence:CCGGTTTGGAGGAGTTCGCAGAAATCTCGAGATTTCTGCGAACTCCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028848.3-721s21c1
Sequence:CCGGCAAAGCAGATTTCAGGTATATCTCGAGATATACCTGAAATCTGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028848.3-519s21c1
Sequence:CCGGGGCTTTAGGATCCGGAAATATCTCGAGATATTTCCGGATCCTAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028848.3-441s21c1
Sequence:CCGGGTTGTTGAGGCAGCATATTATCTCGAGATAATATGCTGCCTCAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028848
SPATA17 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 17
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028848.3-959s21c1
Sequence:CCGGAGTCTTGGAACAGCGTTATAACTCGAGTTATAACGCTGTTCCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028848.3-611s21c1
Sequence:CCGGTTTGGAGGAGTTCGCAGAAATCTCGAGATTTCTGCGAACTCCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028848.3-721s21c1
Sequence:CCGGCAAAGCAGATTTCAGGTATATCTCGAGATATACCTGAAATCTGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028848.3-519s21c1
Sequence:CCGGGGCTTTAGGATCCGGAAATATCTCGAGATATTTCCGGATCCTAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028848.3-441s21c1
Sequence:CCGGGTTGTTGAGGCAGCATATTATCTCGAGATAATATGCTGCCTCAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138796
VALIDATED
SPATA17 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 17
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138796.2-1038s21c1
Sequence:CCGGCAGACTGTATTACCATCATTTCTCGAGAAATGATGGTAATACAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_138796.2-758s21c1
Sequence:CCGGCCGAGATATCACCGAAGTATTCTCGAGAATACTTCGGTGATATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138796.2-161s21c1
Sequence:CCGGATGTCAAGTTCGGGCATATATCTCGAGATATATGCCCGAACTTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_138796.2-713s21c1
Sequence:CCGGTGAAATTCTACCACCTATTAACTCGAGTTAATAGGTGGTAGAATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138796.2-256s21c1
Sequence:CCGGTAACTGTGCAGGTAGCATATTCTCGAGAATATGCTACCTGCACAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138796.2-263s1c1
Sequence:CCGGGCAGGTAGCATATTATACTATCTCGAGATAGTATAATATGCTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138796
VALIDATED
SPATA17 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 17
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138796.2-1038s21c1
Sequence:CCGGCAGACTGTATTACCATCATTTCTCGAGAAATGATGGTAATACAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_138796.2-758s21c1
Sequence:CCGGCCGAGATATCACCGAAGTATTCTCGAGAATACTTCGGTGATATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138796.2-161s21c1
Sequence:CCGGATGTCAAGTTCGGGCATATATCTCGAGATATATGCCCGAACTTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_138796.2-713s21c1
Sequence:CCGGTGAAATTCTACCACCTATTAACTCGAGTTAATAGGTGGTAGAATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138796.2-256s21c1
Sequence:CCGGTAACTGTGCAGGTAGCATATTCTCGAGAATATGCTACCTGCACAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138796.2-263s1c1
Sequence:CCGGGCAGGTAGCATATTATACTATCTCGAGATAGTATAATATGCTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138796
VALIDATED
SPATA17 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 17
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138796.2-1038s21c1
Sequence:CCGGCAGACTGTATTACCATCATTTCTCGAGAAATGATGGTAATACAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_138796.2-758s21c1
Sequence:CCGGCCGAGATATCACCGAAGTATTCTCGAGAATACTTCGGTGATATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138796.2-161s21c1
Sequence:CCGGATGTCAAGTTCGGGCATATATCTCGAGATATATGCCCGAACTTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_138796.2-713s21c1
Sequence:CCGGTGAAATTCTACCACCTATTAACTCGAGTTAATAGGTGGTAGAATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138796.2-256s21c1
Sequence:CCGGTAACTGTGCAGGTAGCATATTCTCGAGAATATGCTACCTGCACAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138796.2-263s1c1
Sequence:CCGGGCAGGTAGCATATTATACTATCTCGAGATAGTATAATATGCTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks