EMAIL THIS PAGE TO A FRIEND

SPATA18

spermatogenesis associated 18

Synonyms: Mieap SPETEX1
UniProtKB ID: Q8TC71, B4E2R0, E5RLK1, Q8IY48, Q8N7D7
Gene ID:
Mouse(73472) spermatogenesis associated 18
Rat(289586) spermatogenesis associated 18
Zebrafish(497395) spermatogenesis associated 18
Horse(100060502) spermatogenesis associated 18
chicken(422759) spermatogenesis associated 18
dog(475141) spermatogenesis associated 18
domestic cat(101093684) spermatogenesis associated 18
cow(615729) spermatogenesis associated 18
sheep(101114110) spermatogenesis associated 18
naked mole-rat(101704342) spermatogenesis associated 18
Domestic Rabbit(100357633) spermatogenesis associated 18
domestic guinea pig(100723929) spermatogenesis associated 18
152 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178387 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178387 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178387 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145263 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145263 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145263 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145263 Rosetta Predictions human pricing
NM_199374 Rosetta Predictions rat pricing
XM_001478951 Rosetta Predictions mouse pricing
XM_001479212 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202047 predicted 1551
2 SASI_Hs01_00202048 predicted 474
3 SASI_Hs01_00202050 predicted 834
4 SASI_Hs01_00202051 predicted 1979
5 SASI_Hs01_00202052 predicted 1753
6 SASI_Hs01_00202053 predicted 306
7 SASI_Hs01_00202054 predicted 673
8 SASI_Hs01_00202055 predicted 1815
9 SASI_Hs01_00202056 predicted 1533
10 SASI_Hs02_00365133 predicted 1695
11 SASI_Hs01_00202049 predicted 1423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199374 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061353 predicted 1465
2 SASI_Rn02_00270182 predicted 1503
3 SASI_Rn01_00061354 predicted 1380
4 SASI_Rn01_00061355 predicted 1764
5 SASI_Rn01_00061356 predicted 1354
6 SASI_Rn01_00061357 predicted 490
7 SASI_Rn01_00061359 predicted 389
8 SASI_Rn01_00061360 predicted 1386
9 SASI_Rn01_00061361 predicted 1398
10 SASI_Rn01_00061362 predicted 595
11 SASI_Rn01_00061358 predicted 1410
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478951 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00406540 predicted 1278
2 SASI_Mm02_00406541 predicted 1693
3 SASI_Mm02_00406542 predicted 1548
4 SASI_Mm02_00406543 predicted 1458
5 SASI_Mm02_00406544 predicted 326
6 SASI_Mm02_00406545 predicted 1560
7 SASI_Mm02_00406546 predicted 531
8 SASI_Mm02_00406547 predicted 1242
9 SASI_Mm02_00406548 predicted 419
10 SASI_Mm02_00406549 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479212 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00408434 predicted 1459
2 SASI_Mm02_00408435 predicted 1628
3 SASI_Mm02_00408436 predicted 1690
4 SASI_Mm02_00408437 predicted 1683
5 SASI_Mm02_00408438 predicted 1549
6 SASI_Mm02_00408439 predicted 1466
7 SASI_Mm02_00408440 predicted 1566
8 SASI_Mm02_00408441 predicted 1362
9 SASI_Mm02_00408442 predicted 1563
10 SASI_Mm02_00408443 predicted 1675
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178387
SPATA18 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 18
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178654    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178387.2-1411s1c1
Sequence:CCGGCCATTTGTCCTCGTAATCATTCTCGAGAATGATTACGAGGACAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178387.2-1002s1c1
Sequence:CCGGCAGTCTCCGAATACATTGTTTCTCGAGAAACAATGTATTCGGAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178387.2-1309s1c1
Sequence:CCGGGAATGACTGTGTCATTATGAACTCGAGTTCATAATGACACAGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178387.3-1733s21c1
Sequence:CCGGCATTTGTCCTCGTAATCATTTCTCGAGAAATGATTACGAGGACAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178387.3-1288s21c1
Sequence:CCGGCATCGAACGTGGGATCTAATACTCGAGTATTAGATCCCACGTTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178387.3-1567s21c1
Sequence:CCGGGCAGCTATGACTCGGACTTTACTCGAGTAAAGTCCGAGTCATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178387.3-1187s21c1
Sequence:CCGGGACGGTGCAGCGGATCATTTACTCGAGTAAATGATCCGCTGCACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178387.3-1685s21c1
Sequence:CCGGGAGTTCCGTGCGACCAGTAATCTCGAGATTACTGGTCGCACGGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178387
SPATA18 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 18
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178654    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178387.2-1411s1c1
Sequence:CCGGCCATTTGTCCTCGTAATCATTCTCGAGAATGATTACGAGGACAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178387.2-1002s1c1
Sequence:CCGGCAGTCTCCGAATACATTGTTTCTCGAGAAACAATGTATTCGGAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178387.2-1309s1c1
Sequence:CCGGGAATGACTGTGTCATTATGAACTCGAGTTCATAATGACACAGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178387.3-1733s21c1
Sequence:CCGGCATTTGTCCTCGTAATCATTTCTCGAGAAATGATTACGAGGACAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178387.3-1288s21c1
Sequence:CCGGCATCGAACGTGGGATCTAATACTCGAGTATTAGATCCCACGTTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178387.3-1567s21c1
Sequence:CCGGGCAGCTATGACTCGGACTTTACTCGAGTAAAGTCCGAGTCATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178387.3-1187s21c1
Sequence:CCGGGACGGTGCAGCGGATCATTTACTCGAGTAAATGATCCGCTGCACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178387.3-1685s21c1
Sequence:CCGGGAGTTCCGTGCGACCAGTAATCTCGAGATTACTGGTCGCACGGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178387
SPATA18 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 18
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178654    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178387.2-1411s1c1
Sequence:CCGGCCATTTGTCCTCGTAATCATTCTCGAGAATGATTACGAGGACAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178387.2-1002s1c1
Sequence:CCGGCAGTCTCCGAATACATTGTTTCTCGAGAAACAATGTATTCGGAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178387.2-1309s1c1
Sequence:CCGGGAATGACTGTGTCATTATGAACTCGAGTTCATAATGACACAGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178387.3-1733s21c1
Sequence:CCGGCATTTGTCCTCGTAATCATTTCTCGAGAAATGATTACGAGGACAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178387.3-1288s21c1
Sequence:CCGGCATCGAACGTGGGATCTAATACTCGAGTATTAGATCCCACGTTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178387.3-1567s21c1
Sequence:CCGGGCAGCTATGACTCGGACTTTACTCGAGTAAAGTCCGAGTCATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178387.3-1187s21c1
Sequence:CCGGGACGGTGCAGCGGATCATTTACTCGAGTAAATGATCCGCTGCACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178387.3-1685s21c1
Sequence:CCGGGAGTTCCGTGCGACCAGTAATCTCGAGATTACTGGTCGCACGGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145263
SPATA18 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 18
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145263.1-1819s1c1
Sequence:CCGGCCCGTAGCCAAATTGGTTTAACTCGAGTTAAACCAATTTGGCTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145263.1-1703s1c1
Sequence:CCGGCATGGAGAATGACTGTGTCATCTCGAGATGACACAGTCATTCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145263.1-2161s1c1
Sequence:CCGGCGAAGCAAAGTCCGTTACAAACTCGAGTTTGTAACGGACTTTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145263.1-495s1c1
Sequence:CCGGGAAACAATCAAGTCACGCCTTCTCGAGAAGGCGTGACTTGATTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145263.1-3516s1c1
Sequence:CCGGGCAGTGAACATAGTACCCTAACTCGAGTTAGGGTACTATGTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145263.1-478s1c1
Sequence:CCGGGACGTAATGATGGTGTGGAAACTCGAGTTTCCACACCATCATTACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145263.1-595s1c1
Sequence:CCGGCGTTTGATAGGGAGAGACATACTCGAGTATGTCTCTCCCTATCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145263.1-1795s1c1
Sequence:CCGGGCAGGAGTTTAAGTCCCATTTCTCGAGAAATGGGACTTAAACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121868    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145263.1-3954s1c1
Sequence:CCGGGCACATATACTGATTTGGAAACTCGAGTTTCCAAATCAGTATATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145263.1-644s1c1
Sequence:CCGGGCAACAGTTAGACTCTAATTTCTCGAGAAATTAGAGTCTAACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145263.1-1401s1c1
Sequence:CCGGGCTGTCTTGGATTATGTCATTCTCGAGAATGACATAATCCAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145263
SPATA18 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 18
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145263.1-1819s1c1
Sequence:CCGGCCCGTAGCCAAATTGGTTTAACTCGAGTTAAACCAATTTGGCTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145263.1-1703s1c1
Sequence:CCGGCATGGAGAATGACTGTGTCATCTCGAGATGACACAGTCATTCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145263.1-2161s1c1
Sequence:CCGGCGAAGCAAAGTCCGTTACAAACTCGAGTTTGTAACGGACTTTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145263.1-495s1c1
Sequence:CCGGGAAACAATCAAGTCACGCCTTCTCGAGAAGGCGTGACTTGATTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145263.1-3516s1c1
Sequence:CCGGGCAGTGAACATAGTACCCTAACTCGAGTTAGGGTACTATGTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145263.1-478s1c1
Sequence:CCGGGACGTAATGATGGTGTGGAAACTCGAGTTTCCACACCATCATTACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145263.1-595s1c1
Sequence:CCGGCGTTTGATAGGGAGAGACATACTCGAGTATGTCTCTCCCTATCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145263.1-1795s1c1
Sequence:CCGGGCAGGAGTTTAAGTCCCATTTCTCGAGAAATGGGACTTAAACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121868    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145263.1-3954s1c1
Sequence:CCGGGCACATATACTGATTTGGAAACTCGAGTTTCCAAATCAGTATATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145263.1-644s1c1
Sequence:CCGGGCAACAGTTAGACTCTAATTTCTCGAGAAATTAGAGTCTAACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145263.1-1401s1c1
Sequence:CCGGGCTGTCTTGGATTATGTCATTCTCGAGAATGACATAATCCAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145263
SPATA18 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 18
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145263.1-1819s1c1
Sequence:CCGGCCCGTAGCCAAATTGGTTTAACTCGAGTTAAACCAATTTGGCTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145263.1-1703s1c1
Sequence:CCGGCATGGAGAATGACTGTGTCATCTCGAGATGACACAGTCATTCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145263.1-2161s1c1
Sequence:CCGGCGAAGCAAAGTCCGTTACAAACTCGAGTTTGTAACGGACTTTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145263.1-495s1c1
Sequence:CCGGGAAACAATCAAGTCACGCCTTCTCGAGAAGGCGTGACTTGATTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145263.1-3516s1c1
Sequence:CCGGGCAGTGAACATAGTACCCTAACTCGAGTTAGGGTACTATGTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145263.1-478s1c1
Sequence:CCGGGACGTAATGATGGTGTGGAAACTCGAGTTTCCACACCATCATTACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145263.1-595s1c1
Sequence:CCGGCGTTTGATAGGGAGAGACATACTCGAGTATGTCTCTCCCTATCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145263.1-1795s1c1
Sequence:CCGGGCAGGAGTTTAAGTCCCATTTCTCGAGAAATGGGACTTAAACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121868    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145263.1-3954s1c1
Sequence:CCGGGCACATATACTGATTTGGAAACTCGAGTTTCCAAATCAGTATATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145263.1-644s1c1
Sequence:CCGGGCAACAGTTAGACTCTAATTTCTCGAGAAATTAGAGTCTAACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145263.1-1401s1c1
Sequence:CCGGGCTGTCTTGGATTATGTCATTCTCGAGAATGACATAATCCAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks