EMAIL THIS PAGE TO A FRIEND

SPATA19

spermatogenesis associated 19

Synonyms: CT132 SPAS1 spergen1
UniProtKB ID: Q7Z5L4, Q8N7A9
Gene ID:
Mouse(75469) spermatogenesis associated 19
Rat(171403) spermatogenesis associated 19
domestic guinea pig(100736033) spermatogenesis associated 19
naked mole-rat(101705111) spermatogenesis associated 19
cow(618276) spermatogenesis associated 19
sheep(101117629) spermatogenesis associated 19
dog(479387) spermatogenesis associated 19
domestic cat(101096261) spermatogenesis associated 19
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029299 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029299 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029299 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_174927 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174927 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174927 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150101 MISSION® esiRNA esiRNA human SPATA19 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174927 Rosetta Predictions human pricing
NM_134384 Rosetta Predictions rat pricing
NM_029299 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010661 predicted 384
2 SASI_Hs01_00010662 predicted 485
3 SASI_Hs01_00010663 predicted 441
4 SASI_Hs01_00010665 predicted 511
5 SASI_Hs01_00010666 predicted 379
6 SASI_Hs01_00010667 predicted 235
7 SASI_Hs01_00010668 predicted 339
8 SASI_Hs01_00010669 predicted 436
9 SASI_Hs01_00010670 predicted 430
10 SASI_Hs02_00368852 predicted 303
11 SASI_Hs01_00010664 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134384 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050296 predicted 274
2 SASI_Rn01_00050297 predicted 354
3 SASI_Rn01_00050298 predicted 257
4 SASI_Rn01_00050299 predicted 315
5 SASI_Rn01_00050300 predicted 271
6 SASI_Rn01_00050301 predicted 364
7 SASI_Rn01_00050302 predicted 395
8 SASI_Rn01_00050303 predicted 390
9 SASI_Rn01_00050304 predicted 347
10 SASI_Rn01_00050305 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029299 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063186 predicted 446
2 SASI_Mm01_00063187 predicted 386
3 SASI_Mm01_00063188 predicted 400
4 SASI_Mm01_00063190 predicted 230
5 SASI_Mm02_00335114 predicted 241
6 SASI_Mm01_00063192 predicted 471
7 SASI_Mm01_00063193 predicted 462
8 SASI_Mm01_00063194 predicted 296
9 SASI_Mm02_00335115 predicted 429
10 SASI_Mm02_00335116 predicted 416
11 SASI_Mm01_00063185 predicted 212
12 SASI_Mm01_00063189 predicted 266
13 SASI_Mm01_00063191 predicted 290
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029299
SPATA19 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 19
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029299.2-409s21c1
Sequence:CCGGGACGTCATGCAGGAACGAATACTCGAGTATTCGTTCCTGCATGACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029299.2-255s21c1
Sequence:CCGGCATACATGTGACCAGAGATTTCTCGAGAAATCTCTGGTCACATGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029299.2-285s21c1
Sequence:CCGGCCATCTCTCAAAGTCTGATATCTCGAGATATCAGACTTTGAGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029299.2-218s21c1
Sequence:CCGGAGATGTCCATCAACGACTCTCCTCGAGGAGAGTCGTTGATGGACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029299.2-432s21c1
Sequence:CCGGTCAAGTGAGACGAAGCGTATCCTCGAGGATACGCTTCGTCTCACTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029299.1-126s1c1
Sequence:CCGGCGGACATTGAAGTTGAAGAAACTCGAGTTTCTTCAACTTCAATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029299.1-535s1c1
Sequence:CCGGGATGAACAGCCTGTGTCCAAACTCGAGTTTGGACACAGGCTGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029299.1-143s1c1
Sequence:CCGGGAAAGCGAAGCTGTATCCGTTCTCGAGAACGGATACAGCTTCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029299.1-352s1c1
Sequence:CCGGCCAGTTTATAAGATGGAGCCACTCGAGTGGCTCCATCTTATAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029299
SPATA19 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 19
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029299.2-409s21c1
Sequence:CCGGGACGTCATGCAGGAACGAATACTCGAGTATTCGTTCCTGCATGACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029299.2-255s21c1
Sequence:CCGGCATACATGTGACCAGAGATTTCTCGAGAAATCTCTGGTCACATGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029299.2-285s21c1
Sequence:CCGGCCATCTCTCAAAGTCTGATATCTCGAGATATCAGACTTTGAGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029299.2-218s21c1
Sequence:CCGGAGATGTCCATCAACGACTCTCCTCGAGGAGAGTCGTTGATGGACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029299.2-432s21c1
Sequence:CCGGTCAAGTGAGACGAAGCGTATCCTCGAGGATACGCTTCGTCTCACTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029299.1-126s1c1
Sequence:CCGGCGGACATTGAAGTTGAAGAAACTCGAGTTTCTTCAACTTCAATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029299.1-535s1c1
Sequence:CCGGGATGAACAGCCTGTGTCCAAACTCGAGTTTGGACACAGGCTGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029299.1-143s1c1
Sequence:CCGGGAAAGCGAAGCTGTATCCGTTCTCGAGAACGGATACAGCTTCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029299.1-352s1c1
Sequence:CCGGCCAGTTTATAAGATGGAGCCACTCGAGTGGCTCCATCTTATAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029299
SPATA19 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 19
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029299.2-409s21c1
Sequence:CCGGGACGTCATGCAGGAACGAATACTCGAGTATTCGTTCCTGCATGACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029299.2-255s21c1
Sequence:CCGGCATACATGTGACCAGAGATTTCTCGAGAAATCTCTGGTCACATGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029299.2-285s21c1
Sequence:CCGGCCATCTCTCAAAGTCTGATATCTCGAGATATCAGACTTTGAGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029299.2-218s21c1
Sequence:CCGGAGATGTCCATCAACGACTCTCCTCGAGGAGAGTCGTTGATGGACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029299.2-432s21c1
Sequence:CCGGTCAAGTGAGACGAAGCGTATCCTCGAGGATACGCTTCGTCTCACTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029299.1-126s1c1
Sequence:CCGGCGGACATTGAAGTTGAAGAAACTCGAGTTTCTTCAACTTCAATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029299.1-535s1c1
Sequence:CCGGGATGAACAGCCTGTGTCCAAACTCGAGTTTGGACACAGGCTGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029299.1-143s1c1
Sequence:CCGGGAAAGCGAAGCTGTATCCGTTCTCGAGAACGGATACAGCTTCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029299.1-352s1c1
Sequence:CCGGCCAGTTTATAAGATGGAGCCACTCGAGTGGCTCCATCTTATAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174927
SPATA19 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 19
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174927.1-116s21c1
Sequence:CCGGCAATAACCAGTTCGGACATTGCTCGAGCAATGTCCGAACTGGTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174927.1-473s21c1
Sequence:CCGGAGCAGGTGAGACGAAGCATATCTCGAGATATGCTTCGTCTCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174927.1-383s21c1
Sequence:CCGGGAACACGAATCCAGTTCATAACTCGAGTTATGAACTGGATTCGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174927.1-451s21c1
Sequence:CCGGGACATCATGCGAGATCGAATACTCGAGTATTCGATCTCGCATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174927.1-594s21c1
Sequence:CCGGGGGTTACAGGGAGTCATCATCCTCGAGGATGATGACTCCCTGTAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174927.1-128s1c1
Sequence:CCGGCGGACATTGACGTTGTGGAAACTCGAGTTTCCACAACGTCAATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174927.1-484s1c1
Sequence:CCGGCGAAGCATATCCCGTCTTACACTCGAGTGTAAGACGGGATATGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174927.1-154s1c1
Sequence:CCGGGCTGTGTCTGTACTACATCATCTCGAGATGATGTAGTACAGACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174927
SPATA19 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 19
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174927.1-116s21c1
Sequence:CCGGCAATAACCAGTTCGGACATTGCTCGAGCAATGTCCGAACTGGTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174927.1-473s21c1
Sequence:CCGGAGCAGGTGAGACGAAGCATATCTCGAGATATGCTTCGTCTCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174927.1-383s21c1
Sequence:CCGGGAACACGAATCCAGTTCATAACTCGAGTTATGAACTGGATTCGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174927.1-451s21c1
Sequence:CCGGGACATCATGCGAGATCGAATACTCGAGTATTCGATCTCGCATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174927.1-594s21c1
Sequence:CCGGGGGTTACAGGGAGTCATCATCCTCGAGGATGATGACTCCCTGTAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174927.1-128s1c1
Sequence:CCGGCGGACATTGACGTTGTGGAAACTCGAGTTTCCACAACGTCAATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174927.1-484s1c1
Sequence:CCGGCGAAGCATATCCCGTCTTACACTCGAGTGTAAGACGGGATATGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174927.1-154s1c1
Sequence:CCGGGCTGTGTCTGTACTACATCATCTCGAGATGATGTAGTACAGACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174927
SPATA19 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 19
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174927.1-116s21c1
Sequence:CCGGCAATAACCAGTTCGGACATTGCTCGAGCAATGTCCGAACTGGTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174927.1-473s21c1
Sequence:CCGGAGCAGGTGAGACGAAGCATATCTCGAGATATGCTTCGTCTCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174927.1-383s21c1
Sequence:CCGGGAACACGAATCCAGTTCATAACTCGAGTTATGAACTGGATTCGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174927.1-451s21c1
Sequence:CCGGGACATCATGCGAGATCGAATACTCGAGTATTCGATCTCGCATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174927.1-594s21c1
Sequence:CCGGGGGTTACAGGGAGTCATCATCCTCGAGGATGATGACTCCCTGTAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174927.1-128s1c1
Sequence:CCGGCGGACATTGACGTTGTGGAAACTCGAGTTTCCACAACGTCAATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174927.1-484s1c1
Sequence:CCGGCGAAGCATATCCCGTCTTACACTCGAGTGTAAGACGGGATATGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174927.1-154s1c1
Sequence:CCGGGCTGTGTCTGTACTACATCATCTCGAGATGATGTAGTACAGACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks