EMAIL THIS PAGE TO A FRIEND

SPATA1

spermatogenesis associated 1

Synonyms: SP-2 SPAP1
UniProtKB ID: Q5VX52, A0PJU9, Q0VDJ9, Q0VDK0, Q6P386, Q9HAR4
Gene ID:
Mouse(70951) spermatogenesis associated 1
Rat(362056) spermatogenesis associated 1
chicken(424537) spermatogenesis associated 1
domestic cat(101091716) spermatogenesis associated 1
Horse(100064787) spermatogenesis associated 1
dog(612554) spermatogenesis associated 1
cow(101905081) spermatogenesis associated 1
cow(100138186) spermatogenesis associated 1
sheep(101111511) spermatogenesis associated 1
naked mole-rat(101709445) spermatogenesis associated 1
domestic guinea pig(100731974) spermatogenesis associated 1
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500643 Anti-SPATA1 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027617 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027617 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027617 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014177 Rosetta Predictions rat pricing
NM_027617 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014177 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116404 predicted 431
2 SASI_Rn01_00116405 predicted 1311
3 SASI_Rn01_00116407 predicted 1227
4 SASI_Rn02_00201674 predicted 1400
5 SASI_Rn01_00116408 predicted 476
6 SASI_Rn01_00116409 predicted 1276
7 SASI_Rn01_00116410 predicted 1041
8 SASI_Rn01_00116412 predicted 576
9 SASI_Rn01_00116413 predicted 899
10 SASI_Rn02_00201675 predicted 1569
11 SASI_Rn01_00116406 predicted 674
12 SASI_Rn01_00116411 predicted 1346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027617 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079919 predicted 538
2 SASI_Mm01_00079920 predicted 1342
3 SASI_Mm01_00079921 predicted 638
4 SASI_Mm01_00079922 predicted 1437
5 SASI_Mm01_00079923 predicted 825
6 SASI_Mm01_00079924 predicted 1308
7 SASI_Mm01_00079925 predicted 812
8 SASI_Mm01_00079927 predicted 1160
9 SASI_Mm01_00079928 predicted 571
10 SASI_Mm02_00332457 predicted 681
11 SASI_Mm01_00079926 predicted 516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027617
SPATA1 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027617.1-1669s1c1
Sequence:CCGGGATCTGACTTTGCTCATCGTACTCGAGTACGATGAGCAAAGTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027617.1-1680s1c1
Sequence:CCGGGCTCATCGTAAGACATCACAACTCGAGTTGTGATGTCTTACGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027617.1-579s1c1
Sequence:CCGGCCTGTAATAGATCACTTAGGACTCGAGTCCTAAGTGATCTATTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027617.1-1500s1c1
Sequence:CCGGGCTGATCTGACACAGAAGAAACTCGAGTTTCTTCTGTGTCAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027617.1-1394s1c1
Sequence:CCGGGCACGCAATTGACCAACTTAACTCGAGTTAAGTTGGTCAATTGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027617
SPATA1 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027617.1-1669s1c1
Sequence:CCGGGATCTGACTTTGCTCATCGTACTCGAGTACGATGAGCAAAGTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027617.1-1680s1c1
Sequence:CCGGGCTCATCGTAAGACATCACAACTCGAGTTGTGATGTCTTACGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027617.1-579s1c1
Sequence:CCGGCCTGTAATAGATCACTTAGGACTCGAGTCCTAAGTGATCTATTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027617.1-1500s1c1
Sequence:CCGGGCTGATCTGACACAGAAGAAACTCGAGTTTCTTCTGTGTCAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027617.1-1394s1c1
Sequence:CCGGGCACGCAATTGACCAACTTAACTCGAGTTAAGTTGGTCAATTGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027617
SPATA1 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027617.1-1669s1c1
Sequence:CCGGGATCTGACTTTGCTCATCGTACTCGAGTACGATGAGCAAAGTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027617.1-1680s1c1
Sequence:CCGGGCTCATCGTAAGACATCACAACTCGAGTTGTGATGTCTTACGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027617.1-579s1c1
Sequence:CCGGCCTGTAATAGATCACTTAGGACTCGAGTCCTAAGTGATCTATTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027617.1-1500s1c1
Sequence:CCGGGCTGATCTGACACAGAAGAAACTCGAGTTTCTTCTGTGTCAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027617.1-1394s1c1
Sequence:CCGGGCACGCAATTGACCAACTTAACTCGAGTTAAGTTGGTCAATTGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks