EMAIL THIS PAGE TO A FRIEND

SPATA20

spermatogenesis associated 20

Synonyms: SSP411 Tisp78
UniProtKB ID: Q8TB22, Q2TA99, Q2XUZ6, Q6P0P1, Q8WVW3, Q9H747
Gene ID:
Mouse(217116) spermatogenesis associated 20
Rat(360604) spermatogenesis associated 20
domestic guinea pig(100714104) spermatogenesis associated 20
naked mole-rat(101707160) spermatogenesis associated 20
cow(511363) spermatogenesis associated 20
sheep(101105085) spermatogenesis associated 20
Zebrafish(567862) spermatogenesis associated 20
domestic cat(101090155) spermatogenesis associated 20
dog(491082) spermatogenesis associated 20
chicken(422100) spermatogenesis associated 20
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022827 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022827 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022827 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144827 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144827 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144827 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158731 MISSION® esiRNA esiRNA human SPATA20 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022827 Rosetta Predictions human pricing
NM_199402 Rosetta Predictions rat pricing
NM_144827 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356128 predicted 2331
2 SASI_Hs01_00058891 predicted 1235
3 SASI_Hs01_00058892 predicted 267
4 SASI_Hs01_00058893 predicted 1575
5 SASI_Hs01_00058894 predicted 258
6 SASI_Hs01_00058895 predicted 1635
7 SASI_Hs01_00058896 predicted 1659
8 SASI_Hs01_00058897 predicted 679
9 SASI_Hs01_00058898 predicted 252
10 SASI_Hs01_00058900 predicted 1040
11 SASI_Hs01_00058899 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199402 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097156 predicted 511
2 SASI_Rn01_00097157 predicted 1127
3 SASI_Rn01_00097158 predicted 2241
4 SASI_Rn01_00097159 predicted 2161
5 SASI_Rn01_00097160 predicted 860
6 SASI_Rn01_00097161 predicted 1676
7 SASI_Rn02_00270228 predicted 1888
8 SASI_Rn02_00270229 predicted 746
9 SASI_Rn01_00097162 predicted 212
10 SASI_Rn01_00097163 predicted 2036
11 SASI_Rn01_00097164 predicted 827
12 SASI_Rn01_00097165 predicted 1124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144827 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080635 predicted 1228
2 SASI_Mm01_00080636 predicted 1089
3 SASI_Mm01_00080637 predicted 2206
4 SASI_Mm01_00080638 predicted 468
5 SASI_Mm01_00080639 predicted 839
6 SASI_Mm01_00080640 predicted 1046
7 SASI_Mm01_00080641 predicted 712
8 SASI_Mm01_00080642 predicted 2218
9 SASI_Mm01_00080643 predicted 1961
10 SASI_Mm01_00080644 predicted 1640
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022827
VALIDATED
SPATA20 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 20
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022827.2-638s21c1
Sequence:CCGGCCGCACAGTGTTGCTGAGAATCTCGAGATTCTCAGCAACACTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022827.2-1037s21c1
Sequence:CCGGCGTCCCTCACTTTGAGAAGATCTCGAGATCTTCTCAAAGTGAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022827.2-2222s21c1
Sequence:CCGGCCACTCTGTCTACATTCCTAACTCGAGTTAGGAATGTAGACAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022827.2-2449s21c1
Sequence:CCGGGTGAAGCATCCCAACTGACTACTCGAGTAGTCAGTTGGGATGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022827.2-2449s1c1
Sequence:CCGGGTGAAGCATCCCAACTGACTACTCGAGTAGTCAGTTGGGATGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_022827.2-1037s1c1
Sequence:CCGGCGTCCCTCACTTTGAGAAGATCTCGAGATCTTCTCAAAGTGAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_022827.2-2222s1c1
Sequence:CCGGCCACTCTGTCTACATTCCTAACTCGAGTTAGGAATGTAGACAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022827.2-638s1c1
Sequence:CCGGCCGCACAGTGTTGCTGAGAATCTCGAGATTCTCAGCAACACTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_022827.2-272s1c1
Sequence:CCGGCCTCCTACAACATGCCTACAACTCGAGTTGTAGGCATGTTGTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022827
VALIDATED
SPATA20 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 20
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022827.2-638s21c1
Sequence:CCGGCCGCACAGTGTTGCTGAGAATCTCGAGATTCTCAGCAACACTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022827.2-1037s21c1
Sequence:CCGGCGTCCCTCACTTTGAGAAGATCTCGAGATCTTCTCAAAGTGAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022827.2-2222s21c1
Sequence:CCGGCCACTCTGTCTACATTCCTAACTCGAGTTAGGAATGTAGACAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022827.2-2449s21c1
Sequence:CCGGGTGAAGCATCCCAACTGACTACTCGAGTAGTCAGTTGGGATGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022827.2-2449s1c1
Sequence:CCGGGTGAAGCATCCCAACTGACTACTCGAGTAGTCAGTTGGGATGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_022827.2-1037s1c1
Sequence:CCGGCGTCCCTCACTTTGAGAAGATCTCGAGATCTTCTCAAAGTGAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_022827.2-2222s1c1
Sequence:CCGGCCACTCTGTCTACATTCCTAACTCGAGTTAGGAATGTAGACAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022827.2-638s1c1
Sequence:CCGGCCGCACAGTGTTGCTGAGAATCTCGAGATTCTCAGCAACACTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_022827.2-272s1c1
Sequence:CCGGCCTCCTACAACATGCCTACAACTCGAGTTGTAGGCATGTTGTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022827
VALIDATED
SPATA20 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 20
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022827.2-638s21c1
Sequence:CCGGCCGCACAGTGTTGCTGAGAATCTCGAGATTCTCAGCAACACTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022827.2-1037s21c1
Sequence:CCGGCGTCCCTCACTTTGAGAAGATCTCGAGATCTTCTCAAAGTGAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022827.2-2222s21c1
Sequence:CCGGCCACTCTGTCTACATTCCTAACTCGAGTTAGGAATGTAGACAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022827.2-2449s21c1
Sequence:CCGGGTGAAGCATCCCAACTGACTACTCGAGTAGTCAGTTGGGATGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022827.2-2449s1c1
Sequence:CCGGGTGAAGCATCCCAACTGACTACTCGAGTAGTCAGTTGGGATGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_022827.2-1037s1c1
Sequence:CCGGCGTCCCTCACTTTGAGAAGATCTCGAGATCTTCTCAAAGTGAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_022827.2-2222s1c1
Sequence:CCGGCCACTCTGTCTACATTCCTAACTCGAGTTAGGAATGTAGACAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022827.2-638s1c1
Sequence:CCGGCCGCACAGTGTTGCTGAGAATCTCGAGATTCTCAGCAACACTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_022827.2-272s1c1
Sequence:CCGGCCTCCTACAACATGCCTACAACTCGAGTTGTAGGCATGTTGTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144827
SPATA20 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 20
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144827.3-2546s1c1
Sequence:CCGGGCACCTACTCACCATGAAATACTCGAGTATTTCATGGTGAGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144827.3-2311s1c1
Sequence:CCGGCGGGCCACAGTCTACATATTTCTCGAGAAATATGTAGACTGTGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144827.3-2019s1c1
Sequence:CCGGCCACAAGGATTGGATGGACAACTCGAGTTGTCCATCCAATCCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144827.3-1107s1c1
Sequence:CCGGCGCTGATGTTGCTAAAGGCATCTCGAGATGCCTTTAGCAACATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144827.3-131s1c1
Sequence:CCGGGTGCTACTACAGTTAGTAGTTCTCGAGAACTACTAACTGTAGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144827
SPATA20 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 20
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144827.3-2546s1c1
Sequence:CCGGGCACCTACTCACCATGAAATACTCGAGTATTTCATGGTGAGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144827.3-2311s1c1
Sequence:CCGGCGGGCCACAGTCTACATATTTCTCGAGAAATATGTAGACTGTGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144827.3-2019s1c1
Sequence:CCGGCCACAAGGATTGGATGGACAACTCGAGTTGTCCATCCAATCCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144827.3-1107s1c1
Sequence:CCGGCGCTGATGTTGCTAAAGGCATCTCGAGATGCCTTTAGCAACATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144827.3-131s1c1
Sequence:CCGGGTGCTACTACAGTTAGTAGTTCTCGAGAACTACTAACTGTAGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144827
SPATA20 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 20
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144827.3-2546s1c1
Sequence:CCGGGCACCTACTCACCATGAAATACTCGAGTATTTCATGGTGAGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144827.3-2311s1c1
Sequence:CCGGCGGGCCACAGTCTACATATTTCTCGAGAAATATGTAGACTGTGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144827.3-2019s1c1
Sequence:CCGGCCACAAGGATTGGATGGACAACTCGAGTTGTCCATCCAATCCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144827.3-1107s1c1
Sequence:CCGGCGCTGATGTTGCTAAAGGCATCTCGAGATGCCTTTAGCAACATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144827.3-131s1c1
Sequence:CCGGGTGCTACTACAGTTAGTAGTTCTCGAGAACTACTAACTGTAGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks