EMAIL THIS PAGE TO A FRIEND

SPATA21

spermatogenesis associated 21

Synonyms: spergen-2 spergen2
UniProtKB ID: Q7Z572
Gene ID:
Mouse(329972) spermatogenesis associated 21
Rat(366491) spermatogenesis associated 21
domestic cat(101084122) spermatogenesis associated 21
dog(487418) spermatogenesis associated 21
cow(789347) spermatogenesis associated 21
sheep(101109523) spermatogenesis associated 21
naked mole-rat(101724322) spermatogenesis associated 21
domestic guinea pig(100735558) spermatogenesis associated 21
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177867 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177867 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177867 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198546 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198546 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198546 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU074521 MISSION® esiRNA esiRNA targeting mouse Spata21 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198546 Rosetta Predictions human pricing
NM_001004447 Rosetta Predictions rat pricing
XM_001072456 Rosetta Predictions rat pricing
XM_579139 Rosetta Predictions rat pricing
NM_177867 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372150 predicted 1180
2 SASI_Hs01_00230502 predicted 1295
3 SASI_Hs01_00230503 predicted 1445
4 SASI_Hs01_00230505 predicted 1122
5 SASI_Hs01_00230507 predicted 1462
6 SASI_Hs01_00230509 predicted 1736
7 SASI_Hs02_00372151 predicted 1599
8 SASI_Hs01_00230510 predicted 1145
9 SASI_Hs01_00230511 predicted 702
10 SASI_Hs02_00372152 predicted 713
11 SASI_Hs01_00230504 predicted 1279
12 SASI_Hs01_00230506 predicted 1552
13 SASI_Hs01_00230508 predicted 1275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004447 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099673 predicted 1822
2 SASI_Rn01_00099675 predicted 1688
3 SASI_Rn01_00099677 predicted 680
4 SASI_Rn02_00198352 predicted 1687
5 SASI_Rn01_00099678 predicted 1648
6 SASI_Rn02_00198353 predicted 1643
7 SASI_Rn01_00099679 predicted 1999
8 SASI_Rn01_00099680 predicted 2173
9 SASI_Rn01_00099681 predicted 2155
10 SASI_Rn01_00099682 predicted 1581
11 SASI_Rn01_00099674 predicted 413
12 SASI_Rn01_00099676 predicted 1787
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072456 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339238 predicted 203
2 SASI_Rn02_00339239 predicted 724
3 SASI_Rn02_00339240 predicted 518
4 SASI_Rn02_00339241 predicted 414
5 SASI_Rn02_00339242 predicted 658
6 SASI_Rn02_00339243 predicted 624
7 SASI_Rn02_00339244 predicted 586
8 SASI_Rn02_00339245 predicted 938
9 SASI_Rn02_00339246 predicted 241
10 SASI_Rn02_00339247 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00174852 predicted 409
2 SASI_Rn01_00174853 predicted 2056
3 SASI_Rn01_00174854 predicted 312
4 SASI_Rn01_00174855 predicted 315
5 SASI_Rn01_00174856 predicted 2012
6 SASI_Rn01_00174857 predicted 2176
7 SASI_Rn01_00174858 predicted 2163
8 SASI_Rn01_00174859 predicted 2153
9 SASI_Rn01_00174860 predicted 2160
10 SASI_Rn01_00174861 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177867 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159227 predicted 1726
2 SASI_Mm01_00159228 predicted 495
3 SASI_Mm01_00159229 predicted 1871
4 SASI_Mm01_00159230 predicted 2232
5 SASI_Mm01_00159231 predicted 1064
6 SASI_Mm01_00159232 predicted 1582
7 SASI_Mm01_00159233 predicted 870
8 SASI_Mm01_00159234 predicted 1822
9 SASI_Mm01_00159235 predicted 1661
10 SASI_Mm01_00159236 predicted 1767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177867
SPATA21 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 21
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177867.2-1666s1c1
Sequence:CCGGCCGAAGCTACTTTGATATCTTCTCGAGAAGATATCAAAGTAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177867.2-504s1c1
Sequence:CCGGCCACTGAAAGGGACAACAGAACTCGAGTTCTGTTGTCCCTTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177867.2-2153s1c1
Sequence:CCGGCAGCAGAACTATGCTGCCAATCTCGAGATTGGCAGCATAGTTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177867.2-1981s1c1
Sequence:CCGGGATCACTAACTACTATCAGAACTCGAGTTCTGATAGTAGTTAGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177867.2-1588s1c1
Sequence:CCGGGCATAGCCTCTTCAGAATGTACTCGAGTACATTCTGAAGAGGCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177867
SPATA21 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 21
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177867.2-1666s1c1
Sequence:CCGGCCGAAGCTACTTTGATATCTTCTCGAGAAGATATCAAAGTAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177867.2-504s1c1
Sequence:CCGGCCACTGAAAGGGACAACAGAACTCGAGTTCTGTTGTCCCTTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177867.2-2153s1c1
Sequence:CCGGCAGCAGAACTATGCTGCCAATCTCGAGATTGGCAGCATAGTTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177867.2-1981s1c1
Sequence:CCGGGATCACTAACTACTATCAGAACTCGAGTTCTGATAGTAGTTAGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177867.2-1588s1c1
Sequence:CCGGGCATAGCCTCTTCAGAATGTACTCGAGTACATTCTGAAGAGGCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177867
SPATA21 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 21
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177867.2-1666s1c1
Sequence:CCGGCCGAAGCTACTTTGATATCTTCTCGAGAAGATATCAAAGTAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177867.2-504s1c1
Sequence:CCGGCCACTGAAAGGGACAACAGAACTCGAGTTCTGTTGTCCCTTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177867.2-2153s1c1
Sequence:CCGGCAGCAGAACTATGCTGCCAATCTCGAGATTGGCAGCATAGTTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177867.2-1981s1c1
Sequence:CCGGGATCACTAACTACTATCAGAACTCGAGTTCTGATAGTAGTTAGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177867.2-1588s1c1
Sequence:CCGGGCATAGCCTCTTCAGAATGTACTCGAGTACATTCTGAAGAGGCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198546
SPATA21 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 21
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198546.1-1595s1c1
Sequence:CCGGGCTCAGAAGTTCCAGAACGAACTCGAGTTCGTTCTGGAACTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198546.1-1462s1c1
Sequence:CCGGGCAGTCTTAGAGGAAATCACACTCGAGTGTGATTTCCTCTAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198546.1-1812s1c1
Sequence:CCGGCCAGTCAGGATCTCAAGGAAACTCGAGTTTCCTTGAGATCCTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198546.1-1161s1c1
Sequence:CCGGCCGCAGCTACTTTGAGATCTTCTCGAGAAGATCTCAAAGTAGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198546.1-1213s1c1
Sequence:CCGGCTGAAGAATATCCTGCTCCTACTCGAGTAGGAGCAGGATATTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198546.1-1274s21c1
Sequence:CCGGTGATGAGTGCTGATGTCAATGCTCGAGCATTGACATCAGCACTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198546.1-1409s21c1
Sequence:CCGGCTCTACTCTTTGAGATCCTGTCTCGAGACAGGATCTCAAAGAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198546.1-1557s21c1
Sequence:CCGGGTTGCAGAAGCTTCCCTACAACTCGAGTTGTAGGGAAGCTTCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198546
SPATA21 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 21
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198546.1-1595s1c1
Sequence:CCGGGCTCAGAAGTTCCAGAACGAACTCGAGTTCGTTCTGGAACTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198546.1-1462s1c1
Sequence:CCGGGCAGTCTTAGAGGAAATCACACTCGAGTGTGATTTCCTCTAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198546.1-1812s1c1
Sequence:CCGGCCAGTCAGGATCTCAAGGAAACTCGAGTTTCCTTGAGATCCTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198546.1-1161s1c1
Sequence:CCGGCCGCAGCTACTTTGAGATCTTCTCGAGAAGATCTCAAAGTAGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198546.1-1213s1c1
Sequence:CCGGCTGAAGAATATCCTGCTCCTACTCGAGTAGGAGCAGGATATTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198546.1-1274s21c1
Sequence:CCGGTGATGAGTGCTGATGTCAATGCTCGAGCATTGACATCAGCACTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198546.1-1409s21c1
Sequence:CCGGCTCTACTCTTTGAGATCCTGTCTCGAGACAGGATCTCAAAGAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198546.1-1557s21c1
Sequence:CCGGGTTGCAGAAGCTTCCCTACAACTCGAGTTGTAGGGAAGCTTCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198546
SPATA21 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 21
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198546.1-1595s1c1
Sequence:CCGGGCTCAGAAGTTCCAGAACGAACTCGAGTTCGTTCTGGAACTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198546.1-1462s1c1
Sequence:CCGGGCAGTCTTAGAGGAAATCACACTCGAGTGTGATTTCCTCTAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198546.1-1812s1c1
Sequence:CCGGCCAGTCAGGATCTCAAGGAAACTCGAGTTTCCTTGAGATCCTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198546.1-1161s1c1
Sequence:CCGGCCGCAGCTACTTTGAGATCTTCTCGAGAAGATCTCAAAGTAGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198546.1-1213s1c1
Sequence:CCGGCTGAAGAATATCCTGCTCCTACTCGAGTAGGAGCAGGATATTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198546.1-1274s21c1
Sequence:CCGGTGATGAGTGCTGATGTCAATGCTCGAGCATTGACATCAGCACTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198546.1-1409s21c1
Sequence:CCGGCTCTACTCTTTGAGATCCTGTCTCGAGACAGGATCTCAAAGAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198546.1-1557s21c1
Sequence:CCGGGTTGCAGAAGCTTCCCTACAACTCGAGTTGTAGGGAAGCTTCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks