EMAIL THIS PAGE TO A FRIEND

SPATA22

spermatogenesis associated 22

Synonyms: NYD-SP20 NYDSP20
UniProtKB ID: Q8NHS9, B4DXB1, D3DTI9, J3KN63, Q969H3, Q96JT4
Gene ID:
Mouse(380709) spermatogenesis associated 22
Rat(360565) spermatogenesis associated 22
domestic guinea pig(100729635) spermatogenesis associated 22
naked mole-rat(101718256) spermatogenesis associated 22
cow(539692) spermatogenesis associated 22
sheep(101121182) spermatogenesis associated 22
chicken(771958) spermatogenesis associated 22
Horse(100060419) spermatogenesis associated 22
domestic cat(101094461) spermatogenesis associated 22
dog(480658) spermatogenesis associated 22
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1102789 Anti-SPATA22 (156-170) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2103234 Anti-SPATA22, (N-terminal) antibody produced in rabbit affinity isolated antibody human, mouse, rabbit, horse, pig, guinea pig, bovine, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032598 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032598 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032598 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001045531 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001045531 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001045531 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032598 Rosetta Predictions human pricing
XM_340842 Rosetta Predictions rat pricing
NM_001045531 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150572 predicted 914
2 SASI_Hs01_00150573 predicted 751
3 SASI_Hs01_00150574 predicted 1047
4 SASI_Hs01_00150575 predicted 754
5 SASI_Hs01_00150576 predicted 274
6 SASI_Hs01_00150577 predicted 1139
7 SASI_Hs01_00150578 predicted 968
8 SASI_Hs01_00150579 predicted 468
9 SASI_Hs01_00150580 predicted 634
10 SASI_Hs01_00150581 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340842 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391989 predicted 473
2 SASI_Rn02_00391990 predicted 318
3 SASI_Rn02_00391991 predicted 1023
4 SASI_Rn02_00391992 predicted 474
5 SASI_Rn02_00391993 predicted 574
6 SASI_Rn02_00391994 predicted 235
7 SASI_Rn02_00391995 predicted 640
8 SASI_Rn02_00391996 predicted 338
9 SASI_Rn02_00391997 predicted 429
10 SASI_Rn02_00391998 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045531 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291654 predicted 910
2 SASI_Mm02_00291655 predicted 526
3 SASI_Mm02_00291656 predicted 912
4 SASI_Mm02_00291657 predicted 228
5 SASI_Mm02_00291658 predicted 527
6 SASI_Mm02_00291659 predicted 312
7 SASI_Mm02_00291660 predicted 762
8 SASI_Mm02_00291661 predicted 367
9 SASI_Mm02_00291662 predicted 760
10 SASI_Mm02_00291663 predicted 564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032598
SPATA22 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 22
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032598.4-466s21c1
Sequence:CCGGCACCGGGCAAATACCACATTCCTCGAGGAATGTGGTATTTGCCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032598.4-1143s21c1
Sequence:CCGGGTGAACTTCCGAGACTGATTACTCGAGTAATCAGTCTCGGAAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032598.4-829s21c1
Sequence:CCGGACAGACACTTAAGCCCAATTTCTCGAGAAATTGGGCTTAAGTGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032598.4-512s21c1
Sequence:CCGGGATTCTGTCTTTAACTCTATTCTCGAGAATAGAGTTAAAGACAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032598.2-293s1c1
Sequence:CCGGGTTCCGTTGTTCAATCAGAAACTCGAGTTTCTGATTGAACAACGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032598.2-1041s1c1
Sequence:CCGGCTGTTCTTGATTCAGCTGTTACTCGAGTAACAGCTGAATCAAGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032598.2-1040s1c1
Sequence:CCGGGCTGTTCTTGATTCAGCTGTTCTCGAGAACAGCTGAATCAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032598.2-728s1c1
Sequence:CCGGCCTAACTTATCTCGCAACAAACTCGAGTTTGTTGCGAGATAAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032598.2-625s1c1
Sequence:CCGGGCCTCAATGTAAACGAACAAACTCGAGTTTGTTCGTTTACATTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032598.2-638s1c1
Sequence:CCGGCGAACAAACTTAGTGGCAAATCTCGAGATTTGCCACTAAGTTTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032598
SPATA22 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 22
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032598.4-466s21c1
Sequence:CCGGCACCGGGCAAATACCACATTCCTCGAGGAATGTGGTATTTGCCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032598.4-1143s21c1
Sequence:CCGGGTGAACTTCCGAGACTGATTACTCGAGTAATCAGTCTCGGAAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032598.4-829s21c1
Sequence:CCGGACAGACACTTAAGCCCAATTTCTCGAGAAATTGGGCTTAAGTGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032598.4-512s21c1
Sequence:CCGGGATTCTGTCTTTAACTCTATTCTCGAGAATAGAGTTAAAGACAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032598.2-293s1c1
Sequence:CCGGGTTCCGTTGTTCAATCAGAAACTCGAGTTTCTGATTGAACAACGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032598.2-1041s1c1
Sequence:CCGGCTGTTCTTGATTCAGCTGTTACTCGAGTAACAGCTGAATCAAGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032598.2-1040s1c1
Sequence:CCGGGCTGTTCTTGATTCAGCTGTTCTCGAGAACAGCTGAATCAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032598.2-728s1c1
Sequence:CCGGCCTAACTTATCTCGCAACAAACTCGAGTTTGTTGCGAGATAAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032598.2-625s1c1
Sequence:CCGGGCCTCAATGTAAACGAACAAACTCGAGTTTGTTCGTTTACATTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032598.2-638s1c1
Sequence:CCGGCGAACAAACTTAGTGGCAAATCTCGAGATTTGCCACTAAGTTTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032598
SPATA22 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 22
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032598.4-466s21c1
Sequence:CCGGCACCGGGCAAATACCACATTCCTCGAGGAATGTGGTATTTGCCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032598.4-1143s21c1
Sequence:CCGGGTGAACTTCCGAGACTGATTACTCGAGTAATCAGTCTCGGAAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032598.4-829s21c1
Sequence:CCGGACAGACACTTAAGCCCAATTTCTCGAGAAATTGGGCTTAAGTGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032598.4-512s21c1
Sequence:CCGGGATTCTGTCTTTAACTCTATTCTCGAGAATAGAGTTAAAGACAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032598.2-293s1c1
Sequence:CCGGGTTCCGTTGTTCAATCAGAAACTCGAGTTTCTGATTGAACAACGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032598.2-1041s1c1
Sequence:CCGGCTGTTCTTGATTCAGCTGTTACTCGAGTAACAGCTGAATCAAGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032598.2-1040s1c1
Sequence:CCGGGCTGTTCTTGATTCAGCTGTTCTCGAGAACAGCTGAATCAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032598.2-728s1c1
Sequence:CCGGCCTAACTTATCTCGCAACAAACTCGAGTTTGTTGCGAGATAAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032598.2-625s1c1
Sequence:CCGGGCCTCAATGTAAACGAACAAACTCGAGTTTGTTCGTTTACATTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032598.2-638s1c1
Sequence:CCGGCGAACAAACTTAGTGGCAAATCTCGAGATTTGCCACTAAGTTTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001045531
SPATA22 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 22
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045531.1-569s21c1
Sequence:CCGGCACCTGAATTTCCTAACTTACCTCGAGGTAAGTTAGGAAATTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045531.1-369s21c1
Sequence:CCGGTCAAGATTCTGTGTCTAAATCCTCGAGGATTTAGACACAGAATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045531.1-765s21c1
Sequence:CCGGAGGTACTTTGCATCAGTTAAACTCGAGTTTAACTGATGCAAAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045531.1-320s21c1
Sequence:CCGGCAGTGAATACAGGGCAAATACCTCGAGGTATTTGCCCTGTATTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045531.1-906s21c1
Sequence:CCGGCACATCTGGCCCACATTATTCCTCGAGGAATAATGTGGGCCAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001045531
SPATA22 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 22
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045531.1-569s21c1
Sequence:CCGGCACCTGAATTTCCTAACTTACCTCGAGGTAAGTTAGGAAATTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045531.1-369s21c1
Sequence:CCGGTCAAGATTCTGTGTCTAAATCCTCGAGGATTTAGACACAGAATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045531.1-765s21c1
Sequence:CCGGAGGTACTTTGCATCAGTTAAACTCGAGTTTAACTGATGCAAAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045531.1-320s21c1
Sequence:CCGGCAGTGAATACAGGGCAAATACCTCGAGGTATTTGCCCTGTATTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045531.1-906s21c1
Sequence:CCGGCACATCTGGCCCACATTATTCCTCGAGGAATAATGTGGGCCAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001045531
SPATA22 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 22
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045531.1-569s21c1
Sequence:CCGGCACCTGAATTTCCTAACTTACCTCGAGGTAAGTTAGGAAATTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045531.1-369s21c1
Sequence:CCGGTCAAGATTCTGTGTCTAAATCCTCGAGGATTTAGACACAGAATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045531.1-765s21c1
Sequence:CCGGAGGTACTTTGCATCAGTTAAACTCGAGTTTAACTGATGCAAAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045531.1-320s21c1
Sequence:CCGGCAGTGAATACAGGGCAAATACCTCGAGGTATTTGCCCTGTATTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045531.1-906s21c1
Sequence:CCGGCACATCTGGCCCACATTATTCCTCGAGGAATAATGTGGGCCAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks