EMAIL THIS PAGE TO A FRIEND

SPATA24

spermatogenesis associated 24

Synonyms: CCDC161 T6441
UniProtKB ID: Q86W54
Gene ID:
Mouse(71242) spermatogenesis associated 24
Rat(291676) spermatogenesis associated 24
domestic cat(101091591) spermatogenesis associated 24
Horse(100062113) spermatogenesis associated 24
dog(612738) spermatogenesis associated 24
cow(506099) spermatogenesis associated 24
sheep(101114953) spermatogenesis associated 24
naked mole-rat(101720851) spermatogenesis associated 24
domestic guinea pig(100732982) spermatogenesis associated 24
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027733 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027733 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027733 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_194296 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194296 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194296 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001721173 Rosetta Predictions human pricing
XM_114430 Rosetta Predictions human pricing
XM_933972 Rosetta Predictions human pricing
XM_940745 Rosetta Predictions human pricing
NM_001025636 Rosetta Predictions rat pricing
NM_027733 Rosetta Predictions mouse pricing
NM_029485 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00441281 predicted 389
2 SASI_Hs02_00441282 predicted 395
3 SASI_Hs02_00441283 predicted 286
4 SASI_Hs02_00441284 predicted 382
5 SASI_Hs02_00441285 predicted 363
6 SASI_Hs02_00441286 predicted 403
7 SASI_Hs02_00441287 predicted 291
8 SASI_Hs02_00441288 predicted 334
9 SASI_Hs02_00441289 predicted 237
10 SASI_Hs02_00441290 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_114430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267519 predicted 394
2 SASI_Hs01_00267520 predicted 395
3 SASI_Hs01_00267521 predicted 290
4 SASI_Hs01_00267522 predicted 376
5 SASI_Hs01_00267523 predicted 369
6 SASI_Hs01_00267524 predicted 407
7 SASI_Hs01_00267525 predicted 290
8 SASI_Hs01_00267527 predicted 336
9 SASI_Hs01_00267528 predicted 240
10 SASI_Hs02_00478865 predicted 318
11 SASI_Hs01_00267526 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280318 predicted 236
2 SASI_Hs01_00280319 predicted 309
3 SASI_Hs01_00280320 predicted 341
4 SASI_Hs01_00280321 predicted 237
5 SASI_Hs01_00280322 predicted 384
6 SASI_Hs01_00280323 predicted 306
7 SASI_Hs01_00280324 predicted 376
8 SASI_Hs01_00280325 predicted 339
9 SASI_Hs01_00280326 predicted 359
10 SASI_Hs01_00280327 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_940745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484389 predicted 396
2 SASI_Hs02_00484390 predicted 397
3 SASI_Hs02_00484391 predicted 291
4 SASI_Hs02_00484392 predicted 378
5 SASI_Hs02_00484393 predicted 364
6 SASI_Hs02_00484394 predicted 408
7 SASI_Hs02_00484395 predicted 286
8 SASI_Hs02_00484396 predicted 336
9 SASI_Hs02_00484397 predicted 237
10 SASI_Hs02_00484398 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025636 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075755 predicted 340
2 SASI_Rn01_00075756 predicted 214
3 SASI_Rn02_00203207 predicted 317
4 SASI_Rn01_00075757 predicted 364
5 SASI_Rn01_00075759 predicted 316
6 SASI_Rn01_00075760 predicted 345
7 SASI_Rn01_00075761 predicted 333
8 SASI_Rn01_00075762 predicted 261
9 SASI_Rn01_00075763 predicted 322
10 SASI_Rn01_00075764 predicted 257
11 SASI_Rn01_00075758 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027733 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181218 predicted 294
2 SASI_Mm01_00181217 predicted 244
3 SASI_Mm01_00181226 predicted 370
4 SASI_Mm01_00181219 predicted 409
5 SASI_Mm01_00181220 predicted 485
6 SASI_Mm01_00181221 predicted 195
7 SASI_Mm01_00181222 predicted 483
8 SASI_Mm01_00181223 predicted 327
9 SASI_Mm02_00332667 predicted 277
10 SASI_Mm02_00332668 predicted 209
11 SASI_Mm01_00181224 predicted 379
12 SASI_Mm01_00181225 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029485 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149960 predicted 449
2 SASI_Mm01_00149961 predicted 290
3 SASI_Mm01_00149962 predicted 447
4 SASI_Mm01_00149969 predicted 426
5 SASI_Mm01_00149964 predicted 437
6 SASI_Mm01_00149965 predicted 432
7 SASI_Mm02_00335414 predicted 241
8 SASI_Mm02_00335415 predicted 429
9 SASI_Mm02_00335416 predicted 373
10 SASI_Mm01_00149963 predicted 408
11 SASI_Mm01_00149966 predicted 287
12 SASI_Mm01_00149967 predicted 418
13 SASI_Mm01_00149968 predicted 329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027733
SPATA24 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 24
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027733.2-343s1c1
Sequence:CCGGGCAGCTGGAGAAAGAGAAGATCTCGAGATCTTCTCTTTCTCCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027733.2-287s1c1
Sequence:CCGGGCCAAGGAAGAAGAGAAGTTACTCGAGTAACTTCTCTTCTTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027733.2-352s1c1
Sequence:CCGGGAAAGAGAAGATGGCCTTTGACTCGAGTCAAAGGCCATCTTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027733.2-227s1c1
Sequence:CCGGGAAATAGAGAAGAAACTGGTGCTCGAGCACCAGTTTCTTCTCTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027733
SPATA24 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 24
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027733.2-343s1c1
Sequence:CCGGGCAGCTGGAGAAAGAGAAGATCTCGAGATCTTCTCTTTCTCCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027733.2-287s1c1
Sequence:CCGGGCCAAGGAAGAAGAGAAGTTACTCGAGTAACTTCTCTTCTTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027733.2-352s1c1
Sequence:CCGGGAAAGAGAAGATGGCCTTTGACTCGAGTCAAAGGCCATCTTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027733.2-227s1c1
Sequence:CCGGGAAATAGAGAAGAAACTGGTGCTCGAGCACCAGTTTCTTCTCTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027733
SPATA24 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 24
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027733.2-343s1c1
Sequence:CCGGGCAGCTGGAGAAAGAGAAGATCTCGAGATCTTCTCTTTCTCCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027733.2-287s1c1
Sequence:CCGGGCCAAGGAAGAAGAGAAGTTACTCGAGTAACTTCTCTTCTTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027733.2-352s1c1
Sequence:CCGGGAAAGAGAAGATGGCCTTTGACTCGAGTCAAAGGCCATCTTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027733.2-227s1c1
Sequence:CCGGGAAATAGAGAAGAAACTGGTGCTCGAGCACCAGTTTCTTCTCTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194296
VALIDATED
SPATA24 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 24
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000268618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194296.1-413s21c1
Sequence:CCGGAGATTGAGTCTCACATTATAACTCGAGTTATAATGTGAGACTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194296.1-86s21c1
Sequence:CCGGATCAACTGCGGGACGTGATTGCTCGAGCAATCACGTCCCGCAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194296.1-452s21c1
Sequence:CCGGATGGCAAAGAGAATGAGATTACTCGAGTAATCTCATTCTCTTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194296.1-504s21c1
Sequence:CCGGACAGATCTTCAGGAATCACATCTCGAGATGTGATTCCTGAAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194296
VALIDATED
SPATA24 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 24
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000268618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194296.1-413s21c1
Sequence:CCGGAGATTGAGTCTCACATTATAACTCGAGTTATAATGTGAGACTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194296.1-86s21c1
Sequence:CCGGATCAACTGCGGGACGTGATTGCTCGAGCAATCACGTCCCGCAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194296.1-452s21c1
Sequence:CCGGATGGCAAAGAGAATGAGATTACTCGAGTAATCTCATTCTCTTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194296.1-504s21c1
Sequence:CCGGACAGATCTTCAGGAATCACATCTCGAGATGTGATTCCTGAAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194296
VALIDATED
SPATA24 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 24
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000268618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194296.1-413s21c1
Sequence:CCGGAGATTGAGTCTCACATTATAACTCGAGTTATAATGTGAGACTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194296.1-86s21c1
Sequence:CCGGATCAACTGCGGGACGTGATTGCTCGAGCAATCACGTCCCGCAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194296.1-452s21c1
Sequence:CCGGATGGCAAAGAGAATGAGATTACTCGAGTAATCTCATTCTCTTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194296.1-504s21c1
Sequence:CCGGACAGATCTTCAGGAATCACATCTCGAGATGTGATTCCTGAAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks