EMAIL THIS PAGE TO A FRIEND

SPATA25

spermatogenesis associated 25

Synonyms: C20orf165 TSG23 dJ337O18.8
UniProtKB ID: Q9BR10
Gene ID:
Mouse(75642) spermatogenesis associated 25
Rat(499943) spermatogenesis associated 25
domestic guinea pig(100719958) spermatogenesis associated 25
naked mole-rat(101703422) spermatogenesis associated 25
cow(101904713) spermatogenesis associated 25
cow(539828) spermatogenesis associated 25
sheep(101113353) spermatogenesis associated 25
dog(100683792) spermatogenesis associated 25
domestic cat(101086050) spermatogenesis associated 25
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080608 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080608 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080608 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080608 Rosetta Predictions human pricing
NM_001025769 Rosetta Predictions rat pricing
XM_130672 Rosetta Predictions mouse pricing
XM_910021 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049256 predicted 280
2 SASI_Hs01_00049257 predicted 243
3 SASI_Hs01_00049258 predicted 439
4 SASI_Hs01_00049259 predicted 241
5 SASI_Hs01_00049260 predicted 452
6 SASI_Hs01_00049261 predicted 404
7 SASI_Hs01_00049262 predicted 265
8 SASI_Hs01_00049263 predicted 266
9 SASI_Hs01_00049264 predicted 195
10 SASI_Hs02_00362355 predicted 404
11 SASI_Hs01_00049255 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025769 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042075 predicted 1166
2 SASI_Rn01_00042076 predicted 926
3 SASI_Rn01_00042077 predicted 890
4 SASI_Rn01_00042078 predicted 952
5 SASI_Rn01_00042079 predicted 1136
6 SASI_Rn02_00203446 predicted 726
7 SASI_Rn01_00042080 predicted 899
8 SASI_Rn02_00203447 predicted 810
9 SASI_Rn01_00042082 predicted 286
10 SASI_Rn01_00042083 predicted 1043
11 SASI_Rn01_00042074 predicted 662
12 SASI_Rn01_00042081 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206190 predicted 300
2 SASI_Mm01_00206191 predicted 278
3 SASI_Mm02_00424374 predicted 277
4 SASI_Mm01_00206194 predicted 310
5 SASI_Mm02_00424375 predicted 304
6 SASI_Mm02_00424376 predicted 305
7 SASI_Mm02_00424377 predicted 303
8 SASI_Mm01_00206198 predicted 280
9 SASI_Mm02_00424378 predicted 294
10 SASI_Mm02_00424379 predicted 226
11 SASI_Mm01_00206192 predicted 482
12 SASI_Mm01_00206193 predicted 480
13 SASI_Mm01_00206195 predicted 525
14 SASI_Mm01_00206196 predicted 491
15 SASI_Mm01_00206197 predicted 520
16 SASI_Mm01_00206199 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_910021 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435290 predicted 307
2 SASI_Mm02_00435291 predicted 279
3 SASI_Mm02_00435292 predicted 477
4 SASI_Mm02_00435293 predicted 475
5 SASI_Mm02_00435294 predicted 481
6 SASI_Mm02_00435295 predicted 302
7 SASI_Mm02_00435296 predicted 521
8 SASI_Mm02_00435297 predicted 488
9 SASI_Mm02_00435298 predicted 517
10 SASI_Mm02_00435299 predicted 274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080608
SPATA25 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 25
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000268482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080608.3-451s21c1
Sequence:CCGGTCCCAGCCTGATATCTGCATCCTCGAGGATGCAGATATCAGGCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080608.3-321s21c1
Sequence:CCGGGGACAATGGCTACTCCAGAAGCTCGAGCTTCTGGAGTAGCCATTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080608.3-268s21c1
Sequence:CCGGAGCCGAAACTGCCACAAATTCCTCGAGGAATTTGTGGCAGTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080608.3-93s21c1
Sequence:CCGGTGGCCTCTGTAGTCCTGTAGACTCGAGTCTACAGGACTACAGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080608
SPATA25 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 25
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000268482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080608.3-451s21c1
Sequence:CCGGTCCCAGCCTGATATCTGCATCCTCGAGGATGCAGATATCAGGCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080608.3-321s21c1
Sequence:CCGGGGACAATGGCTACTCCAGAAGCTCGAGCTTCTGGAGTAGCCATTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080608.3-268s21c1
Sequence:CCGGAGCCGAAACTGCCACAAATTCCTCGAGGAATTTGTGGCAGTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080608.3-93s21c1
Sequence:CCGGTGGCCTCTGTAGTCCTGTAGACTCGAGTCTACAGGACTACAGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080608
SPATA25 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 25
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000268482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080608.3-451s21c1
Sequence:CCGGTCCCAGCCTGATATCTGCATCCTCGAGGATGCAGATATCAGGCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080608.3-321s21c1
Sequence:CCGGGGACAATGGCTACTCCAGAAGCTCGAGCTTCTGGAGTAGCCATTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080608.3-268s21c1
Sequence:CCGGAGCCGAAACTGCCACAAATTCCTCGAGGAATTTGTGGCAGTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080608.3-93s21c1
Sequence:CCGGTGGCCTCTGTAGTCCTGTAGACTCGAGTCTACAGGACTACAGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks