EMAIL THIS PAGE TO A FRIEND

SPATA2

spermatogenesis associated 2

Synonyms: PD1 tamo
UniProtKB ID: Q9UM82, E1P626, O94857
Gene ID:
Mouse(263876) spermatogenesis associated 2
Rat(114210) spermatogenesis associated 2
Zebrafish(568830) spermatogenesis associated 2
domestic cat(101081532) spermatogenesis associated 2
Horse(100071437) spermatogenesis associated 2
dog(485923) spermatogenesis associated 2
chicken(419355) spermatogenesis associated 2
cow(529745) spermatogenesis associated 2
sheep(101117183) spermatogenesis associated 2
naked mole-rat(101700600) spermatogenesis associated 2
domestic guinea pig(100726469) spermatogenesis associated 2
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006038 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006038 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006038 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_170756 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_170756 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_170756 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006038 Rosetta Predictions human pricing
NM_053675 Rosetta Predictions rat pricing
NM_170756 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108531 predicted 1584
2 SASI_Hs01_00108532 predicted 763
3 SASI_Hs01_00108533 predicted 992
4 SASI_Hs01_00108534 predicted 672
5 SASI_Hs01_00108535 predicted 1283
6 SASI_Hs01_00108536 predicted 905
7 SASI_Hs01_00108537 predicted 1254
8 SASI_Hs01_00108538 predicted 840
9 SASI_Hs01_00108539 predicted 429
10 SASI_Hs01_00108540 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053675 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266413 predicted 318
2 SASI_Rn02_00266414 predicted 1783
3 SASI_Rn01_00041207 predicted 470
4 SASI_Rn02_00266415 predicted 1944
5 SASI_Rn01_00041208 predicted 397
6 SASI_Rn01_00041209 predicted 822
7 SASI_Rn01_00041210 predicted 1796
8 SASI_Rn01_00041211 predicted 1338
9 SASI_Rn01_00041212 predicted 1356
10 SASI_Rn01_00041214 predicted 1764
11 SASI_Rn01_00041213 predicted 844
12 SASI_Rn01_00041215 predicted 1931
13 SASI_Rn01_00041216 predicted 1829
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133111 predicted 370
2 SASI_Mm02_00343605 predicted 645
3 SASI_Mm01_00133114 predicted 603
4 SASI_Mm01_00133115 predicted 1752
5 SASI_Mm01_00133116 predicted 1923
6 SASI_Mm02_00343606 predicted 1018
7 SASI_Mm02_00343607 predicted 949
8 SASI_Mm02_00343608 predicted 1160
9 SASI_Mm01_00133117 predicted 2221
10 SASI_Mm01_00133118 predicted 386
11 SASI_Mm01_00133112 predicted 496
12 SASI_Mm01_00133113 predicted 1966
13 SASI_Mm01_00133119 predicted 1136
14 SASI_Mm01_00133120 predicted 877
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006038
SPATA2 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006038.2-726s1c1
Sequence:CCGGCAGGTGAAGATGGTCTCCTTTCTCGAGAAAGGAGACCATCTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006038.2-791s1c1
Sequence:CCGGCCACTCACAAGTGAAGGACAACTCGAGTTGTCCTTCACTTGTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180843    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006038.2-3715s1c1
Sequence:CCGGGCGCCAGCATTACAGTAACTACTCGAGTAGTTACTGTAATGCTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006038.2-770s1c1
Sequence:CCGGGTGTGAGCAGATGCTAGAAATCTCGAGATTTCTAGCATCTGCTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146374    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006038.2-2405s1c1
Sequence:CCGGCGAGTCCAGTATTAGCTGAATCTCGAGATTCAGCTAATACTGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006038.2-287s1c1
Sequence:CCGGCAAGGATGACTTATTTCGGAACTCGAGTTCCGAAATAAGTCATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006038.3-1971s21c1
Sequence:CCGGTCCACGTGGGAGTTCACTTAGCTCGAGCTAAGTGAACTCCCACGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006038
SPATA2 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006038.2-726s1c1
Sequence:CCGGCAGGTGAAGATGGTCTCCTTTCTCGAGAAAGGAGACCATCTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006038.2-791s1c1
Sequence:CCGGCCACTCACAAGTGAAGGACAACTCGAGTTGTCCTTCACTTGTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180843    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006038.2-3715s1c1
Sequence:CCGGGCGCCAGCATTACAGTAACTACTCGAGTAGTTACTGTAATGCTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006038.2-770s1c1
Sequence:CCGGGTGTGAGCAGATGCTAGAAATCTCGAGATTTCTAGCATCTGCTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146374    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006038.2-2405s1c1
Sequence:CCGGCGAGTCCAGTATTAGCTGAATCTCGAGATTCAGCTAATACTGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006038.2-287s1c1
Sequence:CCGGCAAGGATGACTTATTTCGGAACTCGAGTTCCGAAATAAGTCATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006038.3-1971s21c1
Sequence:CCGGTCCACGTGGGAGTTCACTTAGCTCGAGCTAAGTGAACTCCCACGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006038
SPATA2 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006038.2-726s1c1
Sequence:CCGGCAGGTGAAGATGGTCTCCTTTCTCGAGAAAGGAGACCATCTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006038.2-791s1c1
Sequence:CCGGCCACTCACAAGTGAAGGACAACTCGAGTTGTCCTTCACTTGTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180843    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006038.2-3715s1c1
Sequence:CCGGGCGCCAGCATTACAGTAACTACTCGAGTAGTTACTGTAATGCTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006038.2-770s1c1
Sequence:CCGGGTGTGAGCAGATGCTAGAAATCTCGAGATTTCTAGCATCTGCTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146374    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006038.2-2405s1c1
Sequence:CCGGCGAGTCCAGTATTAGCTGAATCTCGAGATTCAGCTAATACTGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006038.2-287s1c1
Sequence:CCGGCAAGGATGACTTATTTCGGAACTCGAGTTCCGAAATAAGTCATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006038.3-1971s21c1
Sequence:CCGGTCCACGTGGGAGTTCACTTAGCTCGAGCTAAGTGAACTCCCACGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170756
VALIDATED
SPATA2 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170756.1-2837s1c1
Sequence:CCGGGCATGAATCTTGTACCCTGAACTCGAGTTCAGGGTACAAGATTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170756.1-598s1c1
Sequence:CCGGCCGAGCCATTCTAAGGTTCATCTCGAGATGAACCTTAGAATGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170756.1-368s1c1
Sequence:CCGGGTGGACCCTTTATATCGATTTCTCGAGAAATCGATATAAAGGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170756.1-1171s1c1
Sequence:CCGGCCTTCTTCGTAGTACATACTTCTCGAGAAGTATGTACTACGAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170756.1-1687s1c1
Sequence:CCGGCAGAAAGAGTGAGCTGCACAACTCGAGTTGTGCAGCTCACTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170756.2-574s21c1
Sequence:CCGCTACTATGTCAAGTCCACGTTGCTCGAGCAACGTGGACTTGACATAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170756.2-926s21c1
Sequence:CCGGGAGCAGCCAAGGACTACTACACTCGAGTGTAGTAGTCCTTGGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170756
VALIDATED
SPATA2 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170756.1-2837s1c1
Sequence:CCGGGCATGAATCTTGTACCCTGAACTCGAGTTCAGGGTACAAGATTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170756.1-598s1c1
Sequence:CCGGCCGAGCCATTCTAAGGTTCATCTCGAGATGAACCTTAGAATGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170756.1-368s1c1
Sequence:CCGGGTGGACCCTTTATATCGATTTCTCGAGAAATCGATATAAAGGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170756.1-1171s1c1
Sequence:CCGGCCTTCTTCGTAGTACATACTTCTCGAGAAGTATGTACTACGAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170756.1-1687s1c1
Sequence:CCGGCAGAAAGAGTGAGCTGCACAACTCGAGTTGTGCAGCTCACTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170756.2-574s21c1
Sequence:CCGCTACTATGTCAAGTCCACGTTGCTCGAGCAACGTGGACTTGACATAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170756.2-926s21c1
Sequence:CCGGGAGCAGCCAAGGACTACTACACTCGAGTGTAGTAGTCCTTGGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170756
VALIDATED
SPATA2 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170756.1-2837s1c1
Sequence:CCGGGCATGAATCTTGTACCCTGAACTCGAGTTCAGGGTACAAGATTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170756.1-598s1c1
Sequence:CCGGCCGAGCCATTCTAAGGTTCATCTCGAGATGAACCTTAGAATGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170756.1-368s1c1
Sequence:CCGGGTGGACCCTTTATATCGATTTCTCGAGAAATCGATATAAAGGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170756.1-1171s1c1
Sequence:CCGGCCTTCTTCGTAGTACATACTTCTCGAGAAGTATGTACTACGAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170756.1-1687s1c1
Sequence:CCGGCAGAAAGAGTGAGCTGCACAACTCGAGTTGTGCAGCTCACTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170756.2-574s21c1
Sequence:CCGCTACTATGTCAAGTCCACGTTGCTCGAGCAACGTGGACTTGACATAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170756.2-926s21c1
Sequence:CCGGGAGCAGCCAAGGACTACTACACTCGAGTGTAGTAGTCCTTGGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks