EMAIL THIS PAGE TO A FRIEND

SPATA2L

spermatogenesis associated 2-like

Synonyms: C16orf76 tamo
UniProtKB ID: Q8IUW3, D3DX85, Q8NHV3
Gene ID:
Mouse(78779) spermatogenesis associated 2-like
Rat(498963) spermatogenesis associated 2-like
Zebrafish(100003387) spermatogenesis associated 2-like
chicken(427552) spermatogenesis associated 2-like
domestic cat(101080931) spermatogenesis associated 2-like
dog(608743) spermatogenesis associated 2-like
cow(618368) spermatogenesis associated 2-like
sheep(101107982) spermatogenesis associated 2-like
naked mole-rat(101700864) spermatogenesis associated 2-like
domestic guinea pig(100728465) spermatogenesis associated 2-like
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030176 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030176 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030176 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152339 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152339 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152339 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152339 Rosetta Predictions human pricing
NM_001109133 Rosetta Predictions rat pricing
NM_030176 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183672 predicted 1356
2 SASI_Hs01_00183673 predicted 411
3 SASI_Hs01_00183674 predicted 1298
4 SASI_Hs01_00183675 predicted 1475
5 SASI_Hs02_00365957 predicted 340
6 SASI_Hs01_00183677 predicted 1488
7 SASI_Hs01_00183678 predicted 1801
8 SASI_Hs01_00183680 predicted 748
9 SASI_Hs01_00183681 predicted 1751
10 SASI_Hs02_00365958 predicted 423
11 SASI_Hs01_00183676 predicted 353
12 SASI_Hs01_00183679 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109133 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245450 predicted 1574
2 SASI_Rn02_00245451 predicted 1810
3 SASI_Rn02_00245452 predicted 1453
4 SASI_Rn02_00245453 predicted 1980
5 SASI_Rn02_00245454 predicted 1562
6 SASI_Rn02_00245455 predicted 1978
7 SASI_Rn02_00245456 predicted 1145
8 SASI_Rn02_00245457 predicted 1641
9 SASI_Rn02_00245458 predicted 1583
10 SASI_Rn02_00245459 predicted 1589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030176 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119507 predicted 1680
2 SASI_Mm01_00119508 predicted 407
3 SASI_Mm01_00119509 predicted 1619
4 SASI_Mm01_00119510 predicted 1629
5 SASI_Mm01_00119511 predicted 1245
6 SASI_Mm01_00119512 predicted 1848
7 SASI_Mm01_00119513 predicted 1813
8 SASI_Mm01_00119514 predicted 1257
9 SASI_Mm01_00119515 predicted 538
10 SASI_Mm01_00119516 predicted 583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030176
SPATA2L MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 2-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030176.2-566s21c1
Sequence:CCGGGTTGGAGTGTGAGATCCTAAGCTCGAGCTTAGGATCTCACACTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030176.2-1820s21c1
Sequence:CCGGGAAAGAGCAGAGCTTACTTAGCTCGAGCTAAGTAAGCTCTGCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030176.2-1033s21c1
Sequence:CCGGTGAGTCGCTCAGGAGACTTAGCTCGAGCTAAGTCTCCTGAGCGACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030176.2-920s21c1
Sequence:CCGGGGAACCGCCAGCTGATGATATCTCGAGATATCATCAGCTGGCGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030176.2-2044s1c1
Sequence:CCGGGCAGCTAACCAGGAAGAAGTTCTCGAGAACTTCTTCCTGGTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030176.2-1326s1c1
Sequence:CCGGCAGGTGGATAACCTGCTCTATCTCGAGATAGAGCAGGTTATCCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030176.2-198s1c1
Sequence:CCGGCAGATTCTGGTGGAAGACTTTCTCGAGAAAGTCTTCCACCAGAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030176.2-368s1c1
Sequence:CCGGGAGAAAGGAGTTCACCACTATCTCGAGATAGTGGTGAACTCCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030176.2-1262s1c1
Sequence:CCGGCCCGACTCATTCACTGCGCATCTCGAGATGCGCAGTGAATGAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030176
SPATA2L MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 2-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030176.2-566s21c1
Sequence:CCGGGTTGGAGTGTGAGATCCTAAGCTCGAGCTTAGGATCTCACACTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030176.2-1820s21c1
Sequence:CCGGGAAAGAGCAGAGCTTACTTAGCTCGAGCTAAGTAAGCTCTGCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030176.2-1033s21c1
Sequence:CCGGTGAGTCGCTCAGGAGACTTAGCTCGAGCTAAGTCTCCTGAGCGACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030176.2-920s21c1
Sequence:CCGGGGAACCGCCAGCTGATGATATCTCGAGATATCATCAGCTGGCGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030176.2-2044s1c1
Sequence:CCGGGCAGCTAACCAGGAAGAAGTTCTCGAGAACTTCTTCCTGGTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030176.2-1326s1c1
Sequence:CCGGCAGGTGGATAACCTGCTCTATCTCGAGATAGAGCAGGTTATCCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030176.2-198s1c1
Sequence:CCGGCAGATTCTGGTGGAAGACTTTCTCGAGAAAGTCTTCCACCAGAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030176.2-368s1c1
Sequence:CCGGGAGAAAGGAGTTCACCACTATCTCGAGATAGTGGTGAACTCCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030176.2-1262s1c1
Sequence:CCGGCCCGACTCATTCACTGCGCATCTCGAGATGCGCAGTGAATGAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030176
SPATA2L MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 2-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030176.2-566s21c1
Sequence:CCGGGTTGGAGTGTGAGATCCTAAGCTCGAGCTTAGGATCTCACACTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030176.2-1820s21c1
Sequence:CCGGGAAAGAGCAGAGCTTACTTAGCTCGAGCTAAGTAAGCTCTGCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030176.2-1033s21c1
Sequence:CCGGTGAGTCGCTCAGGAGACTTAGCTCGAGCTAAGTCTCCTGAGCGACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030176.2-920s21c1
Sequence:CCGGGGAACCGCCAGCTGATGATATCTCGAGATATCATCAGCTGGCGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030176.2-2044s1c1
Sequence:CCGGGCAGCTAACCAGGAAGAAGTTCTCGAGAACTTCTTCCTGGTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030176.2-1326s1c1
Sequence:CCGGCAGGTGGATAACCTGCTCTATCTCGAGATAGAGCAGGTTATCCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030176.2-198s1c1
Sequence:CCGGCAGATTCTGGTGGAAGACTTTCTCGAGAAAGTCTTCCACCAGAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030176.2-368s1c1
Sequence:CCGGGAGAAAGGAGTTCACCACTATCTCGAGATAGTGGTGAACTCCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030176.2-1262s1c1
Sequence:CCGGCCCGACTCATTCACTGCGCATCTCGAGATGCGCAGTGAATGAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152339
VALIDATED
SPATA2L MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 2-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152339.2-2053s21c1
Sequence:CCGGCTTGGTGGGTCCAGTGGTAATCTCGAGATTACCACTGGACCCACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152339.2-349s21c1
Sequence:CCGGAGGAGTTCACCACCATCAAGACTCGAGTCTTGATGGTGGTGAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152339.2-1087s21c1
Sequence:CCGGTACCAGCCTCAGCCTATAGGTCTCGAGACCTATAGGCTGAGGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_152339.2-739s21c1
Sequence:CCGGTGGACTTATACCGGGACTTGCCTCGAGGCAAGTCCCGGTATAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_152339.2-1300s21c1
Sequence:CCGGTGGACACTCTGCTCTACAACACTCGAGTGTTGTAGAGCAGAGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152339.2-1298s1c1
Sequence:CCGGGATGGACACTCTGCTCTACAACTCGAGTTGTAGAGCAGAGTGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152339.2-1912s1c1
Sequence:CCGGCAGGAAATGACCTGACCTCAACTCGAGTTGAGGTCAGGTCATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152339
VALIDATED
SPATA2L MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 2-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152339.2-2053s21c1
Sequence:CCGGCTTGGTGGGTCCAGTGGTAATCTCGAGATTACCACTGGACCCACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152339.2-349s21c1
Sequence:CCGGAGGAGTTCACCACCATCAAGACTCGAGTCTTGATGGTGGTGAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152339.2-1087s21c1
Sequence:CCGGTACCAGCCTCAGCCTATAGGTCTCGAGACCTATAGGCTGAGGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_152339.2-739s21c1
Sequence:CCGGTGGACTTATACCGGGACTTGCCTCGAGGCAAGTCCCGGTATAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_152339.2-1300s21c1
Sequence:CCGGTGGACACTCTGCTCTACAACACTCGAGTGTTGTAGAGCAGAGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152339.2-1298s1c1
Sequence:CCGGGATGGACACTCTGCTCTACAACTCGAGTTGTAGAGCAGAGTGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152339.2-1912s1c1
Sequence:CCGGCAGGAAATGACCTGACCTCAACTCGAGTTGAGGTCAGGTCATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152339
VALIDATED
SPATA2L MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 2-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152339.2-2053s21c1
Sequence:CCGGCTTGGTGGGTCCAGTGGTAATCTCGAGATTACCACTGGACCCACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152339.2-349s21c1
Sequence:CCGGAGGAGTTCACCACCATCAAGACTCGAGTCTTGATGGTGGTGAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152339.2-1087s21c1
Sequence:CCGGTACCAGCCTCAGCCTATAGGTCTCGAGACCTATAGGCTGAGGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_152339.2-739s21c1
Sequence:CCGGTGGACTTATACCGGGACTTGCCTCGAGGCAAGTCCCGGTATAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_152339.2-1300s21c1
Sequence:CCGGTGGACACTCTGCTCTACAACACTCGAGTGTTGTAGAGCAGAGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152339.2-1298s1c1
Sequence:CCGGGATGGACACTCTGCTCTACAACTCGAGTTGTAGAGCAGAGTGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152339.2-1912s1c1
Sequence:CCGGCAGGAAATGACCTGACCTCAACTCGAGTTGAGGTCAGGTCATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks