EMAIL THIS PAGE TO A FRIEND

SPATA31A1

SPATA31 subfamily A, member 1

Synonyms: C9orf36 C9orf36A FAM75A1
Species: Human SPATA31A1(647060)
UniProtKB ID: Q5TZJ5
Gene ID:
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001085452 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085452 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085452 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085452 Rosetta Predictions human pricing
XM_934260 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317755 predicted 1992
2 SASI_Hs02_00317756 predicted 1918
3 SASI_Hs02_00317757 predicted 1104
4 SASI_Hs02_00317758 predicted 1772
5 SASI_Hs02_00317759 predicted 908
6 SASI_Hs02_00317760 predicted 3788
7 SASI_Hs02_00317761 predicted 1652
8 SASI_Hs02_00317762 predicted 3316
9 SASI_Hs02_00317763 predicted 1375
10 SASI_Hs02_00317764 predicted 2649
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264859 predicted 542
2 SASI_Hs01_00264860 predicted 702
3 SASI_Hs01_00264861 predicted 709
4 SASI_Hs01_00264862 predicted 713
5 SASI_Hs01_00264863 predicted 779
6 SASI_Hs01_00264864 predicted 677
7 SASI_Hs01_00264865 predicted 223
8 SASI_Hs01_00264866 predicted 548
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085452
SPATA31A1 MISSION shRNA Bacterial Glycerol Stock
SPATA31 subfamily A, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085452.1-3364s21c1
Sequence:CCGGAGTCTAGGAAGCCCAACTTAGCTCGAGCTAAGTTGGGCTTCCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085452.1-2187s21c1
Sequence:CCGGTGCACAGAGAGGACTCATATACTCGAGTATATGAGTCCTCTCTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085452.1-60s21c1
Sequence:CCGGCTTAGTGCCTCATCGCTAAACCTCGAGGTTTAGCGATGAGGCACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085452.1-1458s21c1
Sequence:CCGGCCCGAGTGCCAACCCTTTATTCTCGAGAATAAAGGGTTGGCACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085452.1-1323s21c1
Sequence:CCGGTGGGTAACTGACAGGTCTTATCTCGAGATAAGACCTGTCAGTTACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085452
SPATA31A1 MISSION shRNA shRNA Plasmid DNA
SPATA31 subfamily A, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085452.1-3364s21c1
Sequence:CCGGAGTCTAGGAAGCCCAACTTAGCTCGAGCTAAGTTGGGCTTCCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085452.1-2187s21c1
Sequence:CCGGTGCACAGAGAGGACTCATATACTCGAGTATATGAGTCCTCTCTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085452.1-60s21c1
Sequence:CCGGCTTAGTGCCTCATCGCTAAACCTCGAGGTTTAGCGATGAGGCACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085452.1-1458s21c1
Sequence:CCGGCCCGAGTGCCAACCCTTTATTCTCGAGAATAAAGGGTTGGCACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085452.1-1323s21c1
Sequence:CCGGTGGGTAACTGACAGGTCTTATCTCGAGATAAGACCTGTCAGTTACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085452
SPATA31A1 MISSION shRNA Lentiviral Transduction Particles
SPATA31 subfamily A, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085452.1-3364s21c1
Sequence:CCGGAGTCTAGGAAGCCCAACTTAGCTCGAGCTAAGTTGGGCTTCCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085452.1-2187s21c1
Sequence:CCGGTGCACAGAGAGGACTCATATACTCGAGTATATGAGTCCTCTCTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085452.1-60s21c1
Sequence:CCGGCTTAGTGCCTCATCGCTAAACCTCGAGGTTTAGCGATGAGGCACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085452.1-1458s21c1
Sequence:CCGGCCCGAGTGCCAACCCTTTATTCTCGAGAATAAAGGGTTGGCACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085452.1-1323s21c1
Sequence:CCGGTGGGTAACTGACAGGTCTTATCTCGAGATAAGACCTGTCAGTTACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks