EMAIL THIS PAGE TO A FRIEND

SPATA31A2

SPATA31 subfamily A, member 2

Synonyms: FAM75A2
UniProtKB ID: Q5RGS2
Gene ID:
sheep(101112381) SPATA31 subfamily A, member 2
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040065 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040065 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040065 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040065 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040065 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308795 predicted 1994
2 SASI_Hs02_00308796 predicted 1920
3 SASI_Hs01_00142531 predicted 1105
4 SASI_Hs02_00308797 predicted 1774
5 SASI_Hs02_00308798 predicted 901
6 SASI_Hs01_00142532 predicted 3788
7 SASI_Hs02_00308799 predicted 1648
8 SASI_Hs01_00142533 predicted 1374
9 SASI_Hs02_00308800 predicted 2652
10 SASI_Hs02_00308801 predicted 1818
11 SASI_Hs01_00142534 predicted 1119
12 SASI_Hs01_00142535 predicted 1757
13 SASI_Hs01_00142536 predicted 3888
14 SASI_Hs01_00142537 predicted 3668
15 SASI_Hs01_00142538 predicted 3721
16 SASI_Hs01_00142539 predicted 1070
17 SASI_Hs01_00142540 predicted 1187
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040065
SPATA31A2 MISSION shRNA Bacterial Glycerol Stock
SPATA31 subfamily A, member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040065.1-2186s21c1
Sequence:CCGGATGCACAGAGAGGACTCATATCTCGAGATATGAGTCCTCTCTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040065.1-715s21c1
Sequence:CCGGTGCGGGACTCCACACTGATAACTCGAGTTATCAGTGTGGAGTCCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040065.1-59s21c1
Sequence:CCGGACTTAGTGCCTCATCGCTAAACTCGAGTTTAGCGATGAGGCACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040065.1-3041s21c1
Sequence:CCGGTCTTATGGAGGAGGTTGTTAACTCGAGTTAACAACCTCCTCCATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040065.1-1600s21c1
Sequence:CCGGCTTGCCCTGCATCGCAGAATACTCGAGTATTCTGCGATGCAGGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040065.1-2489s21c1
Sequence:CCGGCAAGCCCATTCAGTGCTTTAACTCGAGTTAAAGCACTGAATGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040065.1-2159s21c1
Sequence:CCGGGAGTGACTCGGGAAGTGATTTCTCGAGAAATCACTTCCCGAGTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040065
SPATA31A2 MISSION shRNA shRNA Plasmid DNA
SPATA31 subfamily A, member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040065.1-2186s21c1
Sequence:CCGGATGCACAGAGAGGACTCATATCTCGAGATATGAGTCCTCTCTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040065.1-715s21c1
Sequence:CCGGTGCGGGACTCCACACTGATAACTCGAGTTATCAGTGTGGAGTCCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040065.1-59s21c1
Sequence:CCGGACTTAGTGCCTCATCGCTAAACTCGAGTTTAGCGATGAGGCACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040065.1-3041s21c1
Sequence:CCGGTCTTATGGAGGAGGTTGTTAACTCGAGTTAACAACCTCCTCCATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040065.1-1600s21c1
Sequence:CCGGCTTGCCCTGCATCGCAGAATACTCGAGTATTCTGCGATGCAGGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040065.1-2489s21c1
Sequence:CCGGCAAGCCCATTCAGTGCTTTAACTCGAGTTAAAGCACTGAATGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040065.1-2159s21c1
Sequence:CCGGGAGTGACTCGGGAAGTGATTTCTCGAGAAATCACTTCCCGAGTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040065
SPATA31A2 MISSION shRNA Lentiviral Transduction Particles
SPATA31 subfamily A, member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040065.1-2186s21c1
Sequence:CCGGATGCACAGAGAGGACTCATATCTCGAGATATGAGTCCTCTCTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040065.1-715s21c1
Sequence:CCGGTGCGGGACTCCACACTGATAACTCGAGTTATCAGTGTGGAGTCCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040065.1-59s21c1
Sequence:CCGGACTTAGTGCCTCATCGCTAAACTCGAGTTTAGCGATGAGGCACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040065.1-3041s21c1
Sequence:CCGGTCTTATGGAGGAGGTTGTTAACTCGAGTTAACAACCTCCTCCATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040065.1-1600s21c1
Sequence:CCGGCTTGCCCTGCATCGCAGAATACTCGAGTATTCTGCGATGCAGGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040065.1-2489s21c1
Sequence:CCGGCAAGCCCATTCAGTGCTTTAACTCGAGTTAAAGCACTGAATGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040065.1-2159s21c1
Sequence:CCGGGAGTGACTCGGGAAGTGATTTCTCGAGAAATCACTTCCCGAGTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks