EMAIL THIS PAGE TO A FRIEND

SPATA31A3

SPATA31 subfamily A, member 3

Synonyms: FAM75A3
UniProtKB ID: Q5VYP0
Gene ID:
cow(101906801) SPATA31 subfamily A, member 3
12 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001083124 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001083124 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001083124 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083124 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316884 predicted 1987
2 SASI_Hs02_00316885 predicted 3885
3 SASI_Hs02_00316886 predicted 1924
4 SASI_Hs02_00316887 predicted 1103
5 SASI_Hs02_00316888 predicted 1775
6 SASI_Hs02_00316889 predicted 901
7 SASI_Hs02_00316890 predicted 2738
8 SASI_Hs02_00316891 predicted 1647
9 SASI_Hs02_00316892 predicted 1372
10 SASI_Hs02_00316893 predicted 2651
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001083124
SPATA31A3 MISSION shRNA Bacterial Glycerol Stock
SPATA31 subfamily A, member 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083124.1-3041s21c1
Sequence:CCGGTCTTATGGAGGAGGTTGTTAGCTCGAGCTAACAACCTCCTCCATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083124.1-1325s21c1
Sequence:CCGGGGTAACTGACAGGTCTTATACCTCGAGGTATAAGACCTGTCAGTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083124.1-2161s21c1
Sequence:CCGGGTGACTCGGGAAGTGATTTATCTCGAGATAAATCACTTCCCGAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083124.1-3364s21c1
Sequence:CCGGAGTTTAGGAAGCCCAACTTAGCTCGAGCTAAGTTGGGCTTCCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083124.1-1459s21c1
Sequence:CCGGCCGAGTGCCAACCCTTTATTTCTCGAGAAATAAAGGGTTGGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001083124
SPATA31A3 MISSION shRNA shRNA Plasmid DNA
SPATA31 subfamily A, member 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083124.1-3041s21c1
Sequence:CCGGTCTTATGGAGGAGGTTGTTAGCTCGAGCTAACAACCTCCTCCATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083124.1-1325s21c1
Sequence:CCGGGGTAACTGACAGGTCTTATACCTCGAGGTATAAGACCTGTCAGTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083124.1-2161s21c1
Sequence:CCGGGTGACTCGGGAAGTGATTTATCTCGAGATAAATCACTTCCCGAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083124.1-3364s21c1
Sequence:CCGGAGTTTAGGAAGCCCAACTTAGCTCGAGCTAAGTTGGGCTTCCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083124.1-1459s21c1
Sequence:CCGGCCGAGTGCCAACCCTTTATTTCTCGAGAAATAAAGGGTTGGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001083124
SPATA31A3 MISSION shRNA Lentiviral Transduction Particles
SPATA31 subfamily A, member 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083124.1-3041s21c1
Sequence:CCGGTCTTATGGAGGAGGTTGTTAGCTCGAGCTAACAACCTCCTCCATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083124.1-1325s21c1
Sequence:CCGGGGTAACTGACAGGTCTTATACCTCGAGGTATAAGACCTGTCAGTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083124.1-2161s21c1
Sequence:CCGGGTGACTCGGGAAGTGATTTATCTCGAGATAAATCACTTCCCGAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083124.1-3364s21c1
Sequence:CCGGAGTTTAGGAAGCCCAACTTAGCTCGAGCTAAGTTGGGCTTCCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083124.1-1459s21c1
Sequence:CCGGCCGAGTGCCAACCCTTTATTTCTCGAGAAATAAAGGGTTGGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks