EMAIL THIS PAGE TO A FRIEND

SPATA31A5

SPATA31 subfamily A, member 5

Synonyms: FAM75A5
UniProtKB ID: Q5VU36
Gene ID:
Rat(353306) SPATA31 subfamily A, member 5
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001113541 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001113541 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001113541 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113541 Rosetta Predictions human pricing
NM_001008359 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326051 predicted 1988
2 SASI_Hs02_00326052 predicted 3882
3 SASI_Hs02_00326053 predicted 1917
4 SASI_Hs02_00326054 predicted 1102
5 SASI_Hs02_00326055 predicted 1770
6 SASI_Hs02_00326056 predicted 904
7 SASI_Hs02_00326057 predicted 2739
8 SASI_Hs02_00326058 predicted 1650
9 SASI_Hs02_00326059 predicted 1374
10 SASI_Hs02_00326060 predicted 2651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033471 predicted 1187
2 SASI_Rn02_00199123 predicted 630
3 SASI_Rn01_00033472 predicted 1784
4 SASI_Rn01_00033474 predicted 1816
5 SASI_Rn01_00033475 predicted 1511
6 SASI_Rn01_00033476 predicted 2895
7 SASI_Rn01_00033477 predicted 1390
8 SASI_Rn02_00199124 predicted 839
9 SASI_Rn01_00033478 predicted 2683
10 SASI_Rn01_00033480 predicted 937
11 SASI_Rn01_00033473 predicted 2147
12 SASI_Rn01_00033479 predicted 2197
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001113541
SPATA31A5 MISSION shRNA Bacterial Glycerol Stock
SPATA31 subfamily A, member 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113541.1-1115s21c1
Sequence:CCGGTTTGCGGAATTTGGCTAAATCCTCGAGGATTTAGCCAAATTCCGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113541.1-3364s21c1
Sequence:CCGGAGTCTAGGAAACCCAACTTAGCTCGAGCTAAGTTGGGTTTCCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113541.1-3708s21c1
Sequence:CCGGCGCCATGCCTCGAAGGTAAATCTCGAGATTTACCTTCGAGGCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113541.1-3656s21c1
Sequence:CCGGCATGACGGCAGTTGGACAAATCTCGAGATTTGTCCAACTGCCGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113541.1-2188s21c1
Sequence:CCGGGCACAGAGAGGACTCATATAGCTCGAGCTATATGAGTCCTCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001113541
SPATA31A5 MISSION shRNA shRNA Plasmid DNA
SPATA31 subfamily A, member 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113541.1-1115s21c1
Sequence:CCGGTTTGCGGAATTTGGCTAAATCCTCGAGGATTTAGCCAAATTCCGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113541.1-3364s21c1
Sequence:CCGGAGTCTAGGAAACCCAACTTAGCTCGAGCTAAGTTGGGTTTCCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113541.1-3708s21c1
Sequence:CCGGCGCCATGCCTCGAAGGTAAATCTCGAGATTTACCTTCGAGGCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113541.1-3656s21c1
Sequence:CCGGCATGACGGCAGTTGGACAAATCTCGAGATTTGTCCAACTGCCGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113541.1-2188s21c1
Sequence:CCGGGCACAGAGAGGACTCATATAGCTCGAGCTATATGAGTCCTCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001113541
SPATA31A5 MISSION shRNA Lentiviral Transduction Particles
SPATA31 subfamily A, member 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113541.1-1115s21c1
Sequence:CCGGTTTGCGGAATTTGGCTAAATCCTCGAGGATTTAGCCAAATTCCGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113541.1-3364s21c1
Sequence:CCGGAGTCTAGGAAACCCAACTTAGCTCGAGCTAAGTTGGGTTTCCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113541.1-3708s21c1
Sequence:CCGGCGCCATGCCTCGAAGGTAAATCTCGAGATTTACCTTCGAGGCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113541.1-3656s21c1
Sequence:CCGGCATGACGGCAGTTGGACAAATCTCGAGATTTGTCCAACTGCCGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113541.1-2188s21c1
Sequence:CCGGGCACAGAGAGGACTCATATAGCTCGAGCTATATGAGTCCTCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks