EMAIL THIS PAGE TO A FRIEND

SPATA31A6

SPATA31 subfamily A, member 6

Synonyms: FAM75A6
Species: Human SPATA31A6(389730)
UniProtKB ID: Q5VVP1
Gene ID:
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145196 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145196 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145196 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_041504 Rosetta Predictions human pricing
XR_041505 Rosetta Predictions human pricing
XR_041506 Rosetta Predictions human pricing
XR_041507 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527941 predicted 487
2 SASI_Hs02_00527942 predicted 520
3 SASI_Hs02_00527943 predicted 281
4 SASI_Hs02_00527944 predicted 285
5 SASI_Hs02_00527945 predicted 290
6 SASI_Hs02_00527946 predicted 217
7 SASI_Hs02_00527947 predicted 291
8 SASI_Hs02_00527948 predicted 23
9 SASI_Hs02_00527949 predicted 745
10 SASI_Hs02_00527950 predicted 195
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527951 predicted 2002
2 SASI_Hs02_00527952 predicted 1941
3 SASI_Hs02_00527953 predicted 1792
4 SASI_Hs02_00527954 predicted 3799
5 SASI_Hs02_00527955 predicted 1401
6 SASI_Hs02_00527956 predicted 2665
7 SASI_Hs02_00527957 predicted 1663
8 SASI_Hs02_00527958 predicted 2531
9 SASI_Hs02_00527959 predicted 1827
10 SASI_Hs02_00527960 predicted 1773
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527961 predicted 1792
2 SASI_Hs02_00527962 predicted 1729
3 SASI_Hs02_00527963 predicted 1576
4 SASI_Hs02_00527964 predicted 3594
5 SASI_Hs02_00527965 predicted 1195
6 SASI_Hs02_00527966 predicted 2460
7 SASI_Hs02_00527967 predicted 1461
8 SASI_Hs02_00527968 predicted 2322
9 SASI_Hs02_00527969 predicted 1615
10 SASI_Hs02_00527970 predicted 1558
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527971 predicted 1790
2 SASI_Hs02_00527972 predicted 1724
3 SASI_Hs02_00527973 predicted 1575
4 SASI_Hs02_00527974 predicted 3593
5 SASI_Hs02_00527975 predicted 1195
6 SASI_Hs02_00527976 predicted 2460
7 SASI_Hs02_00527977 predicted 1459
8 SASI_Hs02_00527978 predicted 2314
9 SASI_Hs02_00527979 predicted 1621
10 SASI_Hs02_00527980 predicted 1560
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145196
SPATA31A6 MISSION shRNA Bacterial Glycerol Stock
SPATA31 subfamily A, member 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145196.1-2151s21c1
Sequence:CCGGGACTCGGGAAGTGATTTATTACTCGAGTAATAAATCACTTCCCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145196.1-3695s21c1
Sequence:CCGGGCACCATGCCTCGAAGGTAAACTCGAGTTTACCTTCGAGGCATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145196.1-1446s21c1
Sequence:CCGGTCCCACCGCCAACCCTTTATTCTCGAGAATAAAGGGTTGGCGGTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145196.1-1324s21c1
Sequence:CCGGGGGTAACTGACAGGTCTTATACTCGAGTATAAGACCTGTCAGTTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145196.1-890s21c1
Sequence:CCGGCAGAACCTCGTGCGCCTTTAACTCGAGTTAAAGGCGCACGAGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145196
SPATA31A6 MISSION shRNA shRNA Plasmid DNA
SPATA31 subfamily A, member 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145196.1-2151s21c1
Sequence:CCGGGACTCGGGAAGTGATTTATTACTCGAGTAATAAATCACTTCCCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145196.1-3695s21c1
Sequence:CCGGGCACCATGCCTCGAAGGTAAACTCGAGTTTACCTTCGAGGCATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145196.1-1446s21c1
Sequence:CCGGTCCCACCGCCAACCCTTTATTCTCGAGAATAAAGGGTTGGCGGTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145196.1-1324s21c1
Sequence:CCGGGGGTAACTGACAGGTCTTATACTCGAGTATAAGACCTGTCAGTTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145196.1-890s21c1
Sequence:CCGGCAGAACCTCGTGCGCCTTTAACTCGAGTTAAAGGCGCACGAGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145196
SPATA31A6 MISSION shRNA Lentiviral Transduction Particles
SPATA31 subfamily A, member 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145196.1-2151s21c1
Sequence:CCGGGACTCGGGAAGTGATTTATTACTCGAGTAATAAATCACTTCCCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145196.1-3695s21c1
Sequence:CCGGGCACCATGCCTCGAAGGTAAACTCGAGTTTACCTTCGAGGCATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145196.1-1446s21c1
Sequence:CCGGTCCCACCGCCAACCCTTTATTCTCGAGAATAAAGGGTTGGCGGTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145196.1-1324s21c1
Sequence:CCGGGGGTAACTGACAGGTCTTATACTCGAGTATAAGACCTGTCAGTTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145196.1-890s21c1
Sequence:CCGGCAGAACCTCGTGCGCCTTTAACTCGAGTTAAAGGCGCACGAGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks